ID: 1101190359

View in Genome Browser
Species Human (GRCh38)
Location 12:102326181-102326203
Sequence TAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101190357_1101190359 4 Left 1101190357 12:102326154-102326176 CCTAGAGACTTGTCGAATGGCTT 0: 21
1: 1493
2: 1912
3: 1413
4: 823
Right 1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101190359 Original CRISPR TAAAATGCTGATAGTGATAT GGG Intergenic
No off target data available for this crispr