ID: 1101190936

View in Genome Browser
Species Human (GRCh38)
Location 12:102331625-102331647
Sequence CTGAATCAGCAGAAAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101190933_1101190936 -1 Left 1101190933 12:102331603-102331625 CCTGGACACTTTGAACATGCCTC No data
Right 1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG No data
1101190932_1101190936 2 Left 1101190932 12:102331600-102331622 CCACCTGGACACTTTGAACATGC No data
Right 1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG No data
1101190930_1101190936 26 Left 1101190930 12:102331576-102331598 CCATTGAACTGCAAGATAAGAGT No data
Right 1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101190936 Original CRISPR CTGAATCAGCAGAAAAAGAA GGG Intergenic
No off target data available for this crispr