ID: 1101192348

View in Genome Browser
Species Human (GRCh38)
Location 12:102348081-102348103
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101192348_1101192352 11 Left 1101192348 12:102348081-102348103 CCATGCATATCCTCCTAGAAACT No data
Right 1101192352 12:102348115-102348137 TCCCTTCCATTTGCTTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101192348 Original CRISPR AGTTTCTAGGAGGATATGCA TGG (reversed) Intergenic
No off target data available for this crispr