ID: 1101193044

View in Genome Browser
Species Human (GRCh38)
Location 12:102354526-102354548
Sequence ACCTACGCCTACATTTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101193044_1101193050 16 Left 1101193044 12:102354526-102354548 CCCTCTGAAATGTAGGCGTAGGT No data
Right 1101193050 12:102354565-102354587 TTATCTCCTGCACATACACAGGG No data
1101193044_1101193049 15 Left 1101193044 12:102354526-102354548 CCCTCTGAAATGTAGGCGTAGGT No data
Right 1101193049 12:102354564-102354586 CTTATCTCCTGCACATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101193044 Original CRISPR ACCTACGCCTACATTTCAGA GGG (reversed) Intergenic
No off target data available for this crispr