ID: 1101193047

View in Genome Browser
Species Human (GRCh38)
Location 12:102354551-102354573
Sequence AGGAGATAAGAACTGAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101193047_1101193053 16 Left 1101193047 12:102354551-102354573 CCAAACCTCAGTTCTTATCTCCT No data
Right 1101193053 12:102354590-102354612 AAGACCATGTAGAAGCTGCTAGG No data
1101193047_1101193056 22 Left 1101193047 12:102354551-102354573 CCAAACCTCAGTTCTTATCTCCT No data
Right 1101193056 12:102354596-102354618 ATGTAGAAGCTGCTAGGGCTTGG No data
1101193047_1101193057 23 Left 1101193047 12:102354551-102354573 CCAAACCTCAGTTCTTATCTCCT No data
Right 1101193057 12:102354597-102354619 TGTAGAAGCTGCTAGGGCTTGGG No data
1101193047_1101193049 -10 Left 1101193047 12:102354551-102354573 CCAAACCTCAGTTCTTATCTCCT No data
Right 1101193049 12:102354564-102354586 CTTATCTCCTGCACATACACAGG No data
1101193047_1101193050 -9 Left 1101193047 12:102354551-102354573 CCAAACCTCAGTTCTTATCTCCT No data
Right 1101193050 12:102354565-102354587 TTATCTCCTGCACATACACAGGG No data
1101193047_1101193054 17 Left 1101193047 12:102354551-102354573 CCAAACCTCAGTTCTTATCTCCT No data
Right 1101193054 12:102354591-102354613 AGACCATGTAGAAGCTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101193047 Original CRISPR AGGAGATAAGAACTGAGGTT TGG (reversed) Intergenic
No off target data available for this crispr