ID: 1101193049

View in Genome Browser
Species Human (GRCh38)
Location 12:102354564-102354586
Sequence CTTATCTCCTGCACATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101193041_1101193049 22 Left 1101193041 12:102354519-102354541 CCATACACCCTCTGAAATGTAGG No data
Right 1101193049 12:102354564-102354586 CTTATCTCCTGCACATACACAGG No data
1101193044_1101193049 15 Left 1101193044 12:102354526-102354548 CCCTCTGAAATGTAGGCGTAGGT No data
Right 1101193049 12:102354564-102354586 CTTATCTCCTGCACATACACAGG No data
1101193047_1101193049 -10 Left 1101193047 12:102354551-102354573 CCAAACCTCAGTTCTTATCTCCT No data
Right 1101193049 12:102354564-102354586 CTTATCTCCTGCACATACACAGG No data
1101193045_1101193049 14 Left 1101193045 12:102354527-102354549 CCTCTGAAATGTAGGCGTAGGTT No data
Right 1101193049 12:102354564-102354586 CTTATCTCCTGCACATACACAGG No data
1101193046_1101193049 -9 Left 1101193046 12:102354550-102354572 CCCAAACCTCAGTTCTTATCTCC No data
Right 1101193049 12:102354564-102354586 CTTATCTCCTGCACATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101193049 Original CRISPR CTTATCTCCTGCACATACAC AGG Intergenic
No off target data available for this crispr