ID: 1101193211

View in Genome Browser
Species Human (GRCh38)
Location 12:102355964-102355986
Sequence TTTATTATCTGACATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101193210_1101193211 -5 Left 1101193210 12:102355946-102355968 CCAGTCATGAAAAAAATATTTAT No data
Right 1101193211 12:102355964-102355986 TTTATTATCTGACATGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101193211 Original CRISPR TTTATTATCTGACATGTGCC TGG Intergenic
No off target data available for this crispr