ID: 1101195550

View in Genome Browser
Species Human (GRCh38)
Location 12:102378249-102378271
Sequence ATACTGTGATTGAGGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101195550_1101195552 27 Left 1101195550 12:102378249-102378271 CCTTGTCTCCTCAATCACAGTAT No data
Right 1101195552 12:102378299-102378321 GACTAAATAAATTAATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101195550 Original CRISPR ATACTGTGATTGAGGAGACA AGG (reversed) Intergenic
No off target data available for this crispr