ID: 1101197545

View in Genome Browser
Species Human (GRCh38)
Location 12:102400410-102400432
Sequence GATACCAATTTTCAGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101197544_1101197545 -8 Left 1101197544 12:102400395-102400417 CCAGTGGACTTTCTTGATACCAA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1101197545 12:102400410-102400432 GATACCAATTTTCAGTTGAATGG 0: 1
1: 0
2: 1
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101197545 Original CRISPR GATACCAATTTTCAGTTGAA TGG Intronic
905192670 1:36247822-36247844 GATACAAAATTTCAGTTAAGAGG - Intronic
907646572 1:56250519-56250541 GAGGCCATTTTTCAGATGAAAGG - Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909293085 1:73909495-73909517 GATGCCACTTTTCATTTGGAAGG - Intergenic
909695992 1:78468592-78468614 ATGACCAAATTTCAGTTGAATGG + Intronic
910386378 1:86687726-86687748 GATTCCAGTGTTCAGTTGACTGG - Intergenic
917368591 1:174262207-174262229 GATTACAAGTTTCAGTTCAAAGG - Intronic
918610756 1:186488123-186488145 GATACCAATTTTATTTTAAATGG - Intergenic
920153725 1:203931277-203931299 GATACAAATTTTCAGTTAGAAGG + Intergenic
920939867 1:210471930-210471952 GATACAAAATTTCAGTTAGAAGG - Intronic
921845141 1:219870997-219871019 AATACTAATTTTTACTTGAAAGG + Intronic
922506737 1:226130605-226130627 GATACAAAGTTTCAGTTAGAAGG - Intergenic
1063073391 10:2689777-2689799 ACTGCCAATTTTCAGTTGCATGG + Intergenic
1063169791 10:3497534-3497556 GCTACCAATTTTATTTTGAATGG - Intergenic
1063992294 10:11579203-11579225 AAAACCAATTTTGAGTTGACAGG + Intronic
1066071969 10:31826056-31826078 AAGCCCACTTTTCAGTTGAATGG + Intronic
1066781723 10:38955885-38955907 AAAAGCAATTTTCAGTTAAATGG + Intergenic
1068344973 10:55764334-55764356 GAAACAAAATTTCAGTTGACAGG - Intergenic
1069269241 10:66504160-66504182 GATACAAAATTTCAGTTAAATGG - Intronic
1070402262 10:76063690-76063712 GTTTCCAATTTTCAGTTTAGGGG - Intronic
1070861600 10:79670627-79670649 GAAACAAAATTTCAGTTGACAGG + Intergenic
1071261336 10:83921996-83922018 GATACAAAATTTCAGTTAGATGG + Intergenic
1071642575 10:87327114-87327136 GAAACAAAATTTCAGTTGACAGG - Intergenic
1074322163 10:112413307-112413329 GGTACTAACTTTCAGCTGAAGGG + Exonic
1075232447 10:120692445-120692467 GATACAAAGTTACAGTTGGATGG - Intergenic
1078604714 11:12765018-12765040 GCTGCCAGTTTGCAGTTGAATGG + Intronic
1081302303 11:41467438-41467460 GATATCAATTTTTGTTTGAATGG - Intergenic
1083481159 11:62948490-62948512 GATACCGATTTTCTGTTTGAGGG - Intronic
1084626468 11:70311642-70311664 GATACTGCCTTTCAGTTGAATGG + Intronic
1085894895 11:80627293-80627315 GATATCAATAATGAGTTGAAAGG - Intergenic
1085927283 11:81037421-81037443 GATACCAATTCTCACTTAATTGG + Intergenic
1086748734 11:90463216-90463238 GATACCAAATTTCAGTTAGAAGG + Intergenic
1088185165 11:107158871-107158893 GGTGGCAATTTTCAGGTGAATGG + Intergenic
1089991336 11:122863859-122863881 AATACCCATTTTCAATAGAATGG + Intronic
1094438249 12:30445551-30445573 GATATCAATGTGCAATTGAAAGG - Intergenic
1094746924 12:33355379-33355401 GACACAAATTTTCACTTAAACGG - Intergenic
1095486878 12:42694623-42694645 TAAACCTATTTTCACTTGAAAGG + Intergenic
1097061893 12:56291384-56291406 GATACCAGTTTTCTTTTTAAGGG + Intronic
1097548740 12:61039272-61039294 GATAATAATTTTCAGTCCAAAGG + Intergenic
1097762125 12:63478712-63478734 AATACCAATTTTCTGTATAAAGG + Intergenic
1098812987 12:75119888-75119910 GATATCTTTATTCAGTTGAAAGG - Intronic
1099341346 12:81438920-81438942 GGTACAAATTTTCAGTTAGATGG - Intronic
1099528039 12:83740320-83740342 GACACCAATTCTCAGTACAAAGG - Intergenic
1100666114 12:96755427-96755449 GGTACAAAGTTTCAGTTAAATGG - Intronic
1101197545 12:102400410-102400432 GATACCAATTTTCAGTTGAATGG + Intronic
1103638121 12:122325950-122325972 GCTACAAATTTACATTTGAATGG + Intronic
1104071468 12:125349742-125349764 GATTTCAATTTCCAGTTGAAGGG - Exonic
1106510289 13:30407291-30407313 GATACCCCTTTTCAGTTCCAGGG + Intergenic
1107443564 13:40449771-40449793 TTTACCAATTTTAATTTGAATGG + Intergenic
1108036568 13:46296378-46296400 AATAGCAATGTTCAGATGAATGG + Intergenic
1109179101 13:59191628-59191650 GATACAAAATTTCAGTTAGATGG - Intergenic
1109800625 13:67372920-67372942 GATGCCAAATTTCAGTTTCAAGG - Intergenic
1110027414 13:70558277-70558299 TATACCCATCTGCAGTTGAAAGG - Intergenic
1111410895 13:87875126-87875148 GTTAGCCATTTCCAGTTGAACGG + Intergenic
1112041871 13:95554905-95554927 GATACCATTTCTCAGTGGAATGG - Intronic
1114698467 14:24650781-24650803 GGTACCAATTTTTCTTTGAATGG - Intergenic
1114981010 14:28164573-28164595 GCTAACAATTTGCAGTTGTATGG - Intergenic
1115096669 14:29645970-29645992 GAAACCTATATTCTGTTGAAGGG - Intronic
1115141988 14:30182414-30182436 GTTACCAGTTCTCAGTTGGATGG - Intronic
1115493160 14:33978410-33978432 GAAGCCAATTTTGAGTTGATGGG - Intronic
1116112091 14:40598319-40598341 AATGTCAATCTTCAGTTGAAGGG - Intergenic
1117056328 14:51915659-51915681 AATACCAATTTTCTGTTGTGGGG - Intronic
1117691495 14:58311971-58311993 GATACAAAATTTCAGTTAGAAGG + Intronic
1118084834 14:62402751-62402773 CATTCAAATTTTGAGTTGAAAGG - Intergenic
1118711460 14:68523025-68523047 CTTACCAAGTTTCAGCTGAAGGG - Intronic
1119276411 14:73360713-73360735 GAGACCAATGTACTGTTGAAGGG - Intronic
1120611953 14:86652614-86652636 GAAACCAATTATAAGCTGAAGGG - Intergenic
1122944729 14:105002125-105002147 GATGCAAAATTTCAGTTGCAAGG + Intronic
1128196714 15:65764178-65764200 GATACAAATATTAAGTTTAATGG - Intronic
1131440488 15:92455944-92455966 GATACCACTTTTCATTGGATTGG - Intronic
1132841681 16:1981144-1981166 GATACCCAGTTTCAGTGCAAGGG - Exonic
1134362818 16:13547905-13547927 GAAAACAATTTTGAGCTGAAAGG + Intergenic
1140622721 16:76755573-76755595 GATACCAATGAATAGTTGAATGG - Intergenic
1140640128 16:76961858-76961880 AATAACAAATTTCAGTAGAATGG + Intergenic
1144715712 17:17434360-17434382 GAAATTAATTTTCAGTTGAATGG - Intergenic
1145096848 17:20036652-20036674 GATACCAAATTTCAGTTAGGAGG - Intronic
1150491996 17:65580666-65580688 GATAACATTTTTCAGTTGCAAGG - Intronic
1150640311 17:66945283-66945305 GATTCCAATTTTCATTTTACCGG - Intergenic
1150954245 17:69838657-69838679 GATACAAAATTTCAGTTAGAAGG + Intergenic
1153157734 18:2168060-2168082 GATCCCATTTTTCAGTTTTATGG - Intergenic
1153443028 18:5141764-5141786 GCTACCACATTTTAGTTGAATGG + Intergenic
1153771266 18:8418447-8418469 GAGACCAGTTTGCATTTGAAGGG - Intergenic
1153898305 18:9589936-9589958 GATACCAATACTCAGTTAAAAGG + Intronic
1155312702 18:24539896-24539918 TACACCAAGTTTCAGTTGACAGG + Intergenic
1155885329 18:31200680-31200702 GATACAAAATTTCAGTTAGAAGG - Intergenic
1158142861 18:54274834-54274856 GATAGCAATTTTCAGATGACTGG + Intronic
1158743993 18:60176513-60176535 GATACAAAATTTCAGTTAAGGGG + Intergenic
1163045659 19:14639938-14639960 GATACCAAATTTCAGCTAGACGG - Intronic
925358979 2:3264100-3264122 GATACAAAGTTTCAGTTAAGGGG - Intronic
927404123 2:22748268-22748290 GATTCCAACTTTCAGTAGGATGG - Intergenic
929002289 2:37359473-37359495 TATTCCAATTTTAATTTGAAAGG + Intronic
929220113 2:39455181-39455203 GATACCAACTTTCAATTCCAAGG - Intergenic
934519599 2:95011594-95011616 GATCCCAATTTACAGATGAGGGG + Intergenic
936636425 2:114264043-114264065 GATCCGAATTTTAAGTTCAAAGG + Intergenic
937123305 2:119455838-119455860 GACATGAATTTTCAGATGAAAGG + Intronic
938487749 2:131730724-131730746 GATTCCAATTTTCACTTAGATGG - Intronic
939221417 2:139306765-139306787 AAGAACTATTTTCAGTTGAAAGG - Intergenic
939529047 2:143334759-143334781 GTTACCAATTTTATTTTGAAGGG - Intronic
940739937 2:157495689-157495711 AGTACCATTTTTCAGTTAAATGG - Intergenic
942841748 2:180370089-180370111 GATTCCAATATTCATTTGTATGG - Intergenic
945797492 2:214383028-214383050 GATAGCAGCTTTCAGATGAATGG - Intronic
947006558 2:225518381-225518403 GATACAGAATTTCAGTTGGAAGG + Intronic
947066656 2:226234434-226234456 GAGACAAATTTGAAGTTGAAAGG - Intergenic
947789692 2:232857709-232857731 GAGACAAATTTTCAGCAGAAGGG - Exonic
947944698 2:234091606-234091628 GATGCCAATTTTCTGTTGAATGG - Intergenic
1169150966 20:3289039-3289061 GATTCCAATTTTAAATTGGATGG - Intronic
1173477968 20:43376145-43376167 GATACGAATGTTCAGCTCAAAGG - Intergenic
1173507994 20:43604098-43604120 CATACCAATTTTGACCTGAAGGG - Intronic
1173961938 20:47080531-47080553 GATACAAAATTTCAGTTAATAGG + Intronic
1177557179 21:22706743-22706765 GATAAGAATTCTAAGTTGAAAGG - Intergenic
1177628243 21:23692901-23692923 GATACAAAATTTCAGTTAGACGG - Intergenic
1178291137 21:31369447-31369469 GATACCAAATTACAGCTAAATGG + Intronic
1178323331 21:31622943-31622965 GATACCAATTTAAAGTTTAGGGG + Intergenic
1179520157 21:41937984-41938006 GATACCAAATTTCATTTAGAAGG + Intronic
1182682038 22:32087131-32087153 GATACAAAATTTCAGTTAAGAGG + Intronic
1183537059 22:38408954-38408976 GATACAAAATTTCAGTTAGATGG + Intergenic
1185093257 22:48788891-48788913 GATTCCACTTTTAAGTGGAATGG - Intronic
951405947 3:22297320-22297342 GATAGCTTTTTTCAGATGAAGGG - Intronic
951689001 3:25375816-25375838 CATACCAATTTTGTTTTGAAAGG + Intronic
952540276 3:34360053-34360075 GATCCCAAATTCCAGTGGAATGG - Intergenic
953714101 3:45301293-45301315 CAGACCAATCTTAAGTTGAATGG + Intergenic
955970927 3:64437465-64437487 GATACCCACATTCTGTTGAAAGG - Intronic
957021373 3:75131765-75131787 GGTACAAATTTTCAGTTATAAGG + Intergenic
957481809 3:80807664-80807686 TATAACATCTTTCAGTTGAAAGG + Intergenic
957562602 3:81842368-81842390 GATACAAACATTCAGTTCAATGG + Intergenic
962040742 3:131705115-131705137 AATAAAAATTTTCAATTGAAGGG - Intronic
962459933 3:135601496-135601518 GAAGCCAAAATTCAGTTGAATGG + Intergenic
962674076 3:137740264-137740286 GATACAAAATTTCAGTTAGAAGG - Intergenic
964845889 3:161043802-161043824 GAGACCAATTTACTGCTGAAAGG - Intronic
965084220 3:164073502-164073524 GATACCATTTAACATTTGAAAGG + Intergenic
965682194 3:171263068-171263090 GACAGCAGTTTTCAGTTGGAAGG - Intronic
967002163 3:185346122-185346144 GATACAAAATTTCAGTTAGAAGG - Intronic
971042127 4:22765341-22765363 CATAAAAATTTTCATTTGAAAGG + Intergenic
971748744 4:30619098-30619120 GATTCCAATTTTCAATTGACAGG + Intergenic
971934661 4:33132151-33132173 GAGAACAATTTTCAGTTCTAAGG + Intergenic
972982383 4:44721744-44721766 CATACCAGTTTTTAGTTGATTGG - Intronic
973283720 4:48391250-48391272 GCTACCAACTTTCTCTTGAAAGG + Intronic
976376766 4:84354313-84354335 GGTACCATTTTTCATGTGAAGGG + Intergenic
976764773 4:88588745-88588767 GAAACCATTTTTCAATAGAATGG - Intronic
980235104 4:130095479-130095501 GATATCAATTTTCACTTGCCTGG + Intergenic
986218904 5:5749037-5749059 AATATCAATTTCCAGTAGAATGG - Intergenic
986620173 5:9664596-9664618 AATACCAATTTGCATTTTAATGG - Intronic
987987970 5:25174359-25174381 GAGAACAATTTTCTCTTGAAAGG + Intergenic
988543139 5:32130439-32130461 GATACCAAATTAGAGTTGATAGG - Intronic
988616315 5:32778400-32778422 GAAAACAATTTTAACTTGAATGG + Intronic
991468288 5:66938309-66938331 AAAACCAATTTTCAGTTATATGG - Intronic
993764188 5:91835094-91835116 GATACAAATTTTTAGTTAGATGG - Intergenic
994209001 5:97067230-97067252 GCTACCAAGATTCATTTGAAAGG + Intergenic
994263631 5:97688630-97688652 TCTACAAATTTTCAGTTAAATGG - Intergenic
994659243 5:102633762-102633784 GATACCAATTCTTCTTTGAATGG - Intergenic
995430613 5:112071271-112071293 GATACCAATTTACAGTTAGATGG + Intergenic
995992145 5:118253558-118253580 GAAACCATTGTTCAGTTGAAAGG - Intergenic
996211030 5:120810294-120810316 AATACTATTTTTCATTTGAAAGG - Intergenic
996506232 5:124270575-124270597 AATAACAATTTTCAGTTGTTAGG - Intergenic
996637562 5:125712249-125712271 GATACTGATTTTCAGATGGAAGG - Intergenic
999266051 5:150267467-150267489 GATACAAGTTTACAGTTGCATGG - Intronic
1000422327 5:161053005-161053027 GATACCAATGTTCACTTAAGTGG - Intergenic
1002019661 5:176354940-176354962 GATACCAGTTTTCAGGCAAATGG + Intronic
1002117110 5:176971340-176971362 GACACCATTTTTCATTTAAAAGG + Intronic
1008518570 6:52341685-52341707 TATAACAAGTTTCAGTTGAAAGG + Intergenic
1008974847 6:57413064-57413086 GATACCTATTTTTAGTTAACAGG - Intronic
1009163732 6:60314570-60314592 GATACCTATTTTTAGTTAACAGG - Intergenic
1011549537 6:88517260-88517282 GATACCAATATTCTGCAGAAGGG + Intergenic
1011808521 6:91101070-91101092 CATACTAATTTCTAGTTGAAAGG + Intergenic
1012305026 6:97644780-97644802 GATAACAGTATTCAGTTGAGAGG - Intergenic
1012601299 6:101100752-101100774 GATACAAAATTTCAGTTAGATGG - Intergenic
1013150008 6:107436617-107436639 GATACAAAATTTCAGTTGGGAGG + Intronic
1013569489 6:111407585-111407607 GAAAGCAATTTTCAGTAAAATGG + Intronic
1016271844 6:142299498-142299520 GATACAAAGTTTCAGTTAGAAGG + Intergenic
1016983520 6:149876088-149876110 GATACCAATTTGCAAATGAGAGG - Intergenic
1017312841 6:152993973-152993995 GCTATCACTTTTCAGTAGAAGGG + Intronic
1017685845 6:156913592-156913614 GATACAAAATTTCAGTTAGATGG - Intronic
1018408756 6:163518369-163518391 GATACAAATTTTAACTAGAAGGG + Intronic
1020105773 7:5421641-5421663 GATTTCATTTTTCAGTGGAAAGG - Intronic
1020345485 7:7158042-7158064 TACACCAATTTTCATGTGAAAGG - Intronic
1020830965 7:13095120-13095142 GATACAAAATTTCAGTTAGAAGG + Intergenic
1021382873 7:19989464-19989486 GATACATATTTTAAGTGGAAAGG + Intergenic
1021827745 7:24572470-24572492 GATTTAATTTTTCAGTTGAAAGG - Intergenic
1022256582 7:28664315-28664337 AATACCAAGTTTTACTTGAAGGG - Intronic
1025563019 7:62394295-62394317 AAAAGCAATTTTCAGTTAAATGG + Intergenic
1027748762 7:82113909-82113931 GATGCCAATATTAAGATGAATGG + Intronic
1027825944 7:83116738-83116760 GATACAAAATTTCAGTTAGAAGG - Intronic
1028281086 7:88928675-88928697 CATGCCAATTTTAATTTGAAGGG - Intronic
1028286107 7:89003051-89003073 CTTACCAATTTTCAGAGGAAAGG + Intronic
1028687409 7:93606319-93606341 GATAAAGATTTTCAGTTGGAAGG + Intronic
1031178587 7:118385404-118385426 GATAGTAATTTTTAGTTCAAAGG + Intergenic
1031266105 7:119583325-119583347 GATGCCAATTTTGAGGTAAAGGG - Intergenic
1033901854 7:146152403-146152425 GATACAAAATTTCAGTTAGATGG + Intronic
1035936668 8:3849071-3849093 GATTCCATTTAACAGTTGAAGGG + Intronic
1037143214 8:15541940-15541962 CACGCCAATTTTCATTTGAAGGG + Intronic
1039723717 8:40192674-40192696 GATACCAATTTTCCTTTAACTGG + Intergenic
1041379972 8:57244443-57244465 GACACCCATTTTCCTTTGAAGGG - Intergenic
1041407831 8:57519734-57519756 GATACAAAATTTCAGTTTAGGGG - Intergenic
1041570219 8:59329617-59329639 AATACCAATTTTCAGTTCTTTGG - Intergenic
1042199421 8:66266806-66266828 GATACAAAATTTCAGCTGGATGG + Intergenic
1043649497 8:82573199-82573221 AAAACCAATTTTCAATTTAATGG - Intergenic
1044525986 8:93251481-93251503 GATATAAATTTTCAGCTGCATGG - Intergenic
1044726563 8:95199379-95199401 GATGCCAATTATCTGTTGAGGGG + Intergenic
1044758798 8:95494782-95494804 GATACAAAATTTCAGTTAGAGGG + Intergenic
1045598633 8:103687622-103687644 GATACAAAATTTCAGTTAGATGG - Intronic
1050716862 9:8538835-8538857 AATACCATTCTCCAGTTGAAAGG + Intronic
1050758999 9:9042846-9042868 GATACCAATATTCAGTTCATAGG + Intronic
1055323156 9:75101374-75101396 GGAAACAATTTTCAGTTTAAAGG + Intronic
1055671992 9:78616916-78616938 CATACCAATTTTGAGTTTCAGGG + Intergenic
1057027759 9:91747954-91747976 GATACAAAATTTCAGTTAGAAGG + Intronic
1058067930 9:100569893-100569915 GATACTAAATTTCAGTTAGATGG - Intronic
1058320433 9:103623303-103623325 GATACAAAATTTCAGTTAGAAGG + Intergenic
1060204107 9:121672351-121672373 GACACCAAATTTCAGTTGTCGGG - Intronic
1186966098 X:14787433-14787455 GGTTCCAATTTTCAGTTAGAAGG + Intergenic
1187672299 X:21680268-21680290 AATAGCACTTTTCAGTTGCATGG - Intergenic
1187710457 X:22048152-22048174 GATACCTATTGTCAATTGTAAGG + Intronic
1187803555 X:23092906-23092928 GATTGCAGTTTTCAGTTAAAAGG + Intergenic
1188342161 X:29017053-29017075 GATACCAATGTTCAGAATAAAGG - Intronic
1188995296 X:36877540-36877562 GATACAAAGTTTCAGTTAGATGG + Intergenic
1188998291 X:36913496-36913518 GATACAAAATTTCAGTTACATGG + Intergenic
1193372076 X:80710770-80710792 GATACTAATCATCAGTAGAATGG + Intronic
1193754717 X:85394506-85394528 GATTCCACTTTACAGTTGAAGGG + Intergenic
1194031703 X:88825176-88825198 TATACAAACTTTCAGTTGCAAGG - Intergenic
1194442410 X:93948758-93948780 GATAGCAATTTACAGTATAATGG - Intergenic
1195258538 X:103111384-103111406 GATACAATTTTTCATTTGAAAGG + Intergenic
1197017646 X:121646789-121646811 AATAACAATTTTCTGATGAAAGG - Intergenic
1197253266 X:124236694-124236716 GATACAAAAATTCAGTTAAATGG - Intronic
1197255294 X:124256683-124256705 GATAGCTATTTCCAGTTTAATGG - Intronic
1198429437 X:136550808-136550830 GATACCTACTTTCATTTGGAAGG - Exonic
1199188865 X:144947420-144947442 GATACAAATTTTGAATTAAAAGG + Intergenic
1199274474 X:145925443-145925465 GATACAAAATTTCAGTTGGGAGG + Intergenic
1199922458 X:152422748-152422770 GATACAACATTTCAGTTCAACGG + Intronic