ID: 1101197911

View in Genome Browser
Species Human (GRCh38)
Location 12:102404510-102404532
Sequence CTGACTGAGTAGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101197908_1101197911 28 Left 1101197908 12:102404459-102404481 CCTTCATGAAAGGTAGCTAGTGT 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG 0: 1
1: 0
2: 3
3: 28
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101197911 Original CRISPR CTGACTGAGTAGAAGGAAGA TGG Intronic
900012085 1:122843-122865 CTGACTGAATTCAAGAAAGAAGG - Intergenic
902360560 1:15940580-15940602 CTGACTGACTAGGAGGCAGAAGG - Intergenic
904929001 1:34071597-34071619 ATGACTTAGTGGAAGGTAGATGG - Intronic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
905592960 1:39180713-39180735 CTACCTTAGTAAAAGGAAGAAGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907471017 1:54673507-54673529 CTGACAGACTATAGGGAAGAAGG - Intronic
908602749 1:65758773-65758795 CTGACACTGTGGAAGGAAGATGG + Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909013780 1:70362247-70362269 CAGACTGATTTGGAGGAAGAAGG + Intronic
910793021 1:91070579-91070601 CTGAGTTTGTAGCAGGAAGAGGG + Intergenic
911194371 1:94978768-94978790 ATGACGGAGTAGAAGGTAGTTGG - Exonic
911671584 1:100614317-100614339 CTGACTGAATGGAAGGAACATGG - Intergenic
912587046 1:110776589-110776611 TTGACTGAGAAGAAGCATGAGGG + Intergenic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
915841067 1:159213459-159213481 CTGAATGAGAAGAAGTAACAGGG + Intergenic
916818089 1:168372604-168372626 CTGACTGAGGAAATGGAGGAGGG + Intergenic
917004907 1:170403655-170403677 CTGACTTACTAGAAGAAAGCTGG - Intergenic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
921752669 1:218815243-218815265 CTGAGCCAGTAGAAGGAACATGG + Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924689067 1:246327304-246327326 CTGACTGAAGATAAGAAAGAGGG - Exonic
924765182 1:247025578-247025600 CTGCCTGAATAGAACTAAGAGGG - Intergenic
924920771 1:248626943-248626965 CTGACTGAGCAGAAAGTACATGG + Exonic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1063838370 10:10042448-10042470 TTGTCTGAGTGGAAGGAAGCTGG - Intergenic
1064405998 10:15063876-15063898 CTGACATAATAGAAGGCAGATGG + Intronic
1065432383 10:25672862-25672884 CTGACTTTGTAGTAGTAAGAGGG - Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1070206656 10:74270409-74270431 CTGACTTAGTAGAAGACAGCTGG + Intronic
1070859011 10:79634341-79634363 CTGACTTAATAGAAGAAAAAAGG + Intergenic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1071805616 10:89117279-89117301 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1071986937 10:91061391-91061413 CTGACTGAAAGGAAGGAAGTGGG + Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074189043 10:111119974-111119996 CAGACTGGTTAGGAGGAAGAGGG + Intergenic
1074809747 10:117091825-117091847 CTGGCAGAGTGGGAGGAAGAGGG - Intronic
1075774107 10:124968494-124968516 CTTATTGAGTATAAGGGAGAAGG + Intronic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1077172244 11:1172287-1172309 CTGAGTGTGTAGCAGGATGAAGG + Intronic
1077261950 11:1627079-1627101 CTGACAGAGAAGAATGAAAAGGG - Intergenic
1079105963 11:17572558-17572580 CTGACTGTGTAGAAAGAACAAGG - Intronic
1079524953 11:21374972-21374994 CAAACAGAGAAGAAGGAAGAAGG + Intronic
1080254944 11:30280256-30280278 CAGTCTGAGTAGAAGAAAAAGGG - Intergenic
1080257673 11:30309460-30309482 CTGGCTGAGAAAAAGAAAGAAGG - Intergenic
1080551869 11:33379416-33379438 CTTACTGACTGGAAGCAAGACGG - Intergenic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1083609546 11:63998517-63998539 CTGACTGGGGGGAAGGAAGGCGG - Intronic
1084395736 11:68908795-68908817 AGGACTGAGTACAAGGAGGACGG - Intronic
1084475660 11:69387199-69387221 CTGACCGAGCAGAGGGAGGAAGG - Intergenic
1085519561 11:77130145-77130167 CTGACTGAGCAGAAGGTCAAGGG - Intronic
1085699002 11:78729685-78729707 CTCACCGAGTGGAGGGAAGATGG + Intronic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1085996012 11:81914928-81914950 CTGATTGTGTAGAAGGGATACGG - Intergenic
1086229200 11:84548190-84548212 CTGGCAGTGGAGAAGGAAGAAGG - Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086966331 11:93031926-93031948 CTGCTGGAGTAGAAGGCAGATGG + Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087384923 11:97458776-97458798 AGGAATGAGTAGAAGGCAGAGGG + Intergenic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1088824319 11:113481155-113481177 CTGATTGTGTTGGAGGAAGAGGG - Intergenic
1088986545 11:114914261-114914283 ATGACTGAGAAGAAGGAACAGGG - Intergenic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1090991861 11:131824914-131824936 CTGACAGAGCAGAAGGAACACGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1091932693 12:4409468-4409490 CTGGCTGAGTAGAAGACAGCTGG + Intergenic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092518878 12:9245469-9245491 CTGACAGAATAGAAGAAAAATGG - Intergenic
1092565881 12:9664991-9665013 CTCACATAGTAGAAGGAACAAGG - Intronic
1092878208 12:12866990-12867012 CTGACAGAGTACAAAGAAGTGGG - Intergenic
1092901377 12:13062676-13062698 CTTACTGAGGAGGAGGAAGCAGG - Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093234149 12:16585426-16585448 CTCACTGTGTAGGATGAAGATGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094323667 12:29212978-29213000 GTGACTTAGTGGAATGAAGAAGG - Intronic
1095326265 12:40897007-40897029 CTGACTTAGAAGTTGGAAGATGG + Intronic
1095985456 12:47996328-47996350 GTGACTAAGAAGAATGAAGATGG - Intronic
1096218353 12:49810676-49810698 CTGACTTAATAGAAGGAAGCTGG - Intronic
1097028254 12:56074494-56074516 CTGACTGAATAAATGAAAGAAGG - Intergenic
1097486445 12:60209044-60209066 CTGACTGTGAAAAAGAAAGAAGG + Intergenic
1098095052 12:66946005-66946027 ATAACTGTGTAGCAGGAAGAAGG - Intergenic
1098441668 12:70525673-70525695 CTCACGGAGTATAAGGAAGGGGG - Intronic
1098556066 12:71820327-71820349 GTGACTGAGTAGAATGAGCAAGG - Intergenic
1100736483 12:97539969-97539991 CTGACTGAGTTAAAGGCTGAAGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101976827 12:109366733-109366755 CAAACTGAGTAGAGGCAAGAAGG + Intronic
1102560138 12:113756076-113756098 CTGACCTTGAAGAAGGAAGAAGG + Intergenic
1104580734 12:130009091-130009113 CTGACTGAGTCGGGGGTAGAGGG - Intergenic
1104634221 12:130427595-130427617 CTGCCAGAGCAGAAGGGAGAGGG + Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105717527 13:23082093-23082115 TTGCCTGAGGAGGAGGAAGAAGG - Intergenic
1105881629 13:24611208-24611230 GTGACTGTGAAGATGGAAGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1113027023 13:105951778-105951800 TTGACAGAGTAGAAAGTAGAGGG - Intergenic
1113224755 13:108147454-108147476 GTGGCTGAATAGATGGAAGATGG - Intergenic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1114381544 14:22210244-22210266 GTGAGTGATTAGAAGAAAGAAGG + Intergenic
1114488574 14:23080586-23080608 CTGAAAGAGTTTAAGGAAGAAGG - Exonic
1114811573 14:25906532-25906554 CTGACTGACCAGAAGGAACCAGG + Intergenic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1116677174 14:47920465-47920487 CTCACTGAGAAGAATGAAAATGG - Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1118465098 14:66023671-66023693 GAGACAGAGGAGAAGGAAGATGG - Intergenic
1119122063 14:72088832-72088854 GTGACTGAGGAGCAGAAAGAAGG - Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119745459 14:77040644-77040666 CTCACTGACTAGAGGGAGGAGGG - Intergenic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1122477432 14:102020518-102020540 CAGACTGAGAAACAGGAAGAGGG - Intronic
1123804687 15:23859179-23859201 CAGACTGAATGGCAGGAAGACGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124496376 15:30190072-30190094 GTGTCTGAGTAGCAGGAAGTGGG - Intergenic
1124747199 15:32348576-32348598 GTGTCTGAGTAGCAGGAAGTGGG + Intergenic
1125419142 15:39486789-39486811 AAGACTAAGTAGAAGGAATACGG - Intergenic
1125972842 15:43926099-43926121 CTGAATGAATAGAAGGGAAAAGG + Intronic
1126416973 15:48427883-48427905 CTGGGTGAGAAGAAGCAAGAGGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1130321278 15:82844184-82844206 CTGAATGAGTACAAGGGGGATGG + Intronic
1131580025 15:93634259-93634281 CTGACTGGGGAGACGGAAGCTGG - Intergenic
1132298610 15:100762959-100762981 CTGACAGAGGAGAATGAAGTAGG + Intergenic
1132703065 16:1230172-1230194 CCCACTGGGTAGAAGGAACAGGG - Exonic
1132705257 16:1240696-1240718 CCCACTGGGTAGAAGGAACAGGG + Exonic
1136649326 16:31653639-31653661 CTGACTGATTAGAATAAACATGG - Intergenic
1137541318 16:49364049-49364071 CTGGCTGAGTATAAGGCAGTAGG - Intergenic
1137637134 16:49996345-49996367 CTGCCTGAGCAGGTGGAAGAGGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138150973 16:54656725-54656747 CACAGTGAGTAGATGGAAGAAGG + Intergenic
1139469220 16:67169537-67169559 CTAACTGAGCAGAAGGCAGGCGG + Intronic
1141024721 16:80535203-80535225 CTGACTGGGTAGAATAAACATGG - Intergenic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1142320295 16:89377891-89377913 TTCATTGAGTAGAAGGAGGAGGG - Intronic
1143408106 17:6691347-6691369 CTGACTGGGTATAAGGAAGGAGG - Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1143890253 17:10097327-10097349 TTGACTGAATGGGAGGAAGATGG + Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144534604 17:16075881-16075903 GTGGCTGAGTTGAAGGATGAAGG - Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1147705799 17:42423855-42423877 CTAACAGAGTAGAATTAAGATGG + Intergenic
1147873709 17:43605907-43605929 CTGGCTGAGCAAAAGAAAGAAGG - Intergenic
1150112015 17:62509808-62509830 CTCACAAAGTAGAAGGCAGAAGG - Intronic
1151125388 17:71839226-71839248 CTGAGAGAGATGAAGGAAGATGG - Intergenic
1151505388 17:74523792-74523814 GTGACTCAGTAGAAGCATGAGGG - Intronic
1151908655 17:77066621-77066643 CTGACTTAGAAAGAGGAAGAAGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1155453145 18:25983875-25983897 CTGAATGGGTAGCAGGAACAAGG + Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158574281 18:58623159-58623181 CTGGCTGGGTTGAAGGATGAGGG - Intronic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160357265 18:78238982-78239004 CGGCCTGAGAAGAAGGAAGGAGG + Intergenic
1162304550 19:9863980-9864002 CTACCTGAGTACAAGGAAGGCGG - Intronic
1163222131 19:15929333-15929355 CTGAGAGAGAAGCAGGAAGAGGG + Intronic
1163690908 19:18737766-18737788 CTGGCTGAGGAGGAGGAAAAGGG - Intronic
1164104473 19:22095288-22095310 CTGACTGATTAGAATAAACATGG - Intergenic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164749572 19:30642529-30642551 TTGGCTGATTAGAAGGTAGAAGG + Intronic
1164861292 19:31564245-31564267 TTGACAGAGAAGAAGAAAGAAGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1168119909 19:54246082-54246104 CTCAGTGAGTAAGAGGAAGAGGG - Intronic
925342774 2:3148466-3148488 CTGACTGTGGGGAAGGATGAGGG - Intergenic
925776058 2:7337297-7337319 GGGACTGAATGGAAGGAAGAGGG + Intergenic
927093392 2:19729176-19729198 TTGCCTGGGTAGGAGGAAGAAGG + Intergenic
927361819 2:22244116-22244138 CTCACTGATTAGAAGCAAGTTGG - Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
927912543 2:26911723-26911745 CTGACTGAGGGAAAGGGAGAGGG - Intronic
928101390 2:28439567-28439589 CGGACTGAGGAGGAGGCAGAGGG + Intergenic
928735879 2:34288617-34288639 CTAACAGAGTAGAAGAAAGCCGG + Intergenic
930236714 2:48895574-48895596 CTGACTGATAAGGAGGAAAAAGG - Intergenic
930343112 2:50142834-50142856 CAGACTGAGCAAAAGCAAGAAGG + Intronic
930699461 2:54444862-54444884 TTGAGTGACTAGAAGGAACAAGG + Intergenic
930894940 2:56435080-56435102 CTGACTTTGTAGAATGAATATGG + Intergenic
932547574 2:72730389-72730411 CTGACTGTGCCCAAGGAAGAGGG + Intronic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933606132 2:84385950-84385972 CTGACTGAGTCTCAGTAAGAAGG + Intergenic
936171453 2:110180567-110180589 CTCACTGAGAGGAATGAAGAAGG + Intronic
936454422 2:112661038-112661060 GTGACTGAGTAGAACAAAGCAGG + Intronic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
938613476 2:132973128-132973150 GTGACGGTGTAGAAGGCAGAAGG - Intronic
940950594 2:159668677-159668699 TAAACTAAGTAGAAGGAAGAAGG - Intergenic
942299180 2:174545983-174546005 CTGGCTGAGCAGGTGGAAGAAGG + Intergenic
942577737 2:177382723-177382745 CTGACTTAGTAGAAGACAGCCGG - Intronic
942843019 2:180387022-180387044 ATGAATCAGTAGAATGAAGATGG - Intergenic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
944505450 2:200406031-200406053 CTGAATGAGTAAAAGGAAGCAGG - Intronic
945322016 2:208435556-208435578 CTGACTTCGAAGATGGAAGAAGG + Intronic
946507961 2:220321722-220321744 CTGACTGAGGACAAGGAATATGG + Intergenic
947025132 2:225729464-225729486 CTGCCTGACAAGAAGCAAGAGGG + Intergenic
947228612 2:227863422-227863444 TTAACTGGGTAGAAGGGAGAAGG + Intergenic
947364262 2:229378069-229378091 CTGACTTTGAAGAAGGCAGAAGG + Intronic
1170434931 20:16316583-16316605 CTGAATGACTGGAATGAAGAAGG + Intronic
1171842775 20:30235754-30235776 GTGACAGAATTGAAGGAAGAGGG - Intergenic
1174098699 20:48109996-48110018 GTGAGTGAGTAGAAGGGTGAAGG - Intergenic
1178758459 21:35376519-35376541 CTGAAAGAGTGGAAGGAAGCCGG - Intronic
1179372298 21:40817750-40817772 ATGACAGAGTAGAAGGTAAAAGG + Intronic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1180655733 22:17419070-17419092 CTGACTGACGGGAAGGAAAATGG + Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1184006552 22:41713921-41713943 CTGATTGAGTAGAAGGGCCATGG + Intronic
1184497889 22:44853275-44853297 CAGACTGAGTAGGAGGCACAAGG + Intronic
1185412254 22:50689022-50689044 CTGACAGAGTTGGAGGGAGAGGG - Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949780990 3:7688071-7688093 CTGACTGAGAATAAATAAGAAGG + Intronic
949960826 3:9310690-9310712 CTGACTGCTGAGAAGAAAGAAGG + Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951667470 3:25143272-25143294 CTGACAGTGTAGGATGAAGAGGG + Intergenic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955396107 3:58558835-58558857 ATGACTGAGTAAAACAAAGAAGG - Intergenic
956085088 3:65599442-65599464 GTGAGTGACTAGAAGGAAAAGGG - Intronic
956571078 3:70695837-70695859 ATGTCTGACTAGAAGGCAGAAGG + Intergenic
956958752 3:74373417-74373439 CTGGCTGGGTAAAAGGGAGAAGG - Intronic
957690281 3:83557052-83557074 CTCACTGAGAAGAATGAAAATGG - Intergenic
958264841 3:91426180-91426202 TTGACTGAGAAGAAGCAAGAGGG - Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959191032 3:103112114-103112136 TTGACTCTGAAGAAGGAAGAAGG + Intergenic
959771616 3:110105746-110105768 ATGACTGAGCACAGGGAAGATGG - Intergenic
962203369 3:133417066-133417088 AGGGCTGAGTAGAAGGGAGAGGG - Intronic
963321505 3:143814179-143814201 CTGACTCAGCAGGAGTAAGAGGG + Intronic
965211436 3:165794547-165794569 CTCACATAGTAGAAGGGAGAAGG + Intronic
965867514 3:173223167-173223189 CTAACTCAGTAGAAGGAATGAGG + Intergenic
966026880 3:175294947-175294969 GTGACTGAGTAGAAGTGAGAAGG + Intronic
968914192 4:3490033-3490055 ATTAATGAGTAGGAGGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969625562 4:8303397-8303419 CTGAATGAGTGCAAGAAAGAAGG + Intronic
970349521 4:15187946-15187968 AGGACTGAGAAGAAGAAAGAGGG + Intergenic
971222344 4:24719804-24719826 GTCACTGAGTAGAAGGCAGCAGG - Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
971839550 4:31833854-31833876 CTAAGTGAGTAAAAGAAAGAGGG + Intergenic
971928296 4:33043979-33044001 GTGACTGAGTGGAAAGAAAATGG - Intergenic
972143443 4:35990662-35990684 TTGACAGAGTTTAAGGAAGAAGG + Intronic
972144533 4:36006105-36006127 CTGACAGATGAGAAGGGAGAAGG + Intronic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973533619 4:51858389-51858411 GTGGCTGAGTAGAATGAACAAGG + Intronic
975351297 4:73350360-73350382 CCCACTGAGTAGCAGGAAAAGGG - Intergenic
975366916 4:73540301-73540323 CTTAATGAGTAGAAAAAAGATGG + Intergenic
975660340 4:76682202-76682224 CTGACTGGGAAGAAAGATGAAGG + Intronic
977524469 4:98126638-98126660 CTCACTGAGAAGAATGAAAATGG - Intronic
978298691 4:107239747-107239769 CTGGCTTTGTAGAATGAAGAAGG - Intronic
979564011 4:122134086-122134108 CTGACTGGCTAGTAGGCAGAAGG - Intergenic
981055401 4:140355575-140355597 CTGACTAGGTAGAAGCAATAAGG + Intronic
981291598 4:143082728-143082750 CTGACTTTGAAGATGGAAGAAGG + Intergenic
986581328 5:9269370-9269392 CTGACTCAGTAGAAAGACAATGG + Intronic
987736279 5:21847525-21847547 CTGCCTTAGAGGAAGGAAGAAGG - Intronic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
989684922 5:44074428-44074450 CATACTGAGGAAAAGGAAGAAGG + Intergenic
990561981 5:56992417-56992439 CTGACAGAGGTGAAAGAAGAGGG + Intergenic
992483254 5:77171851-77171873 CTGACTGACTGGAAGCCAGAGGG + Intergenic
992787524 5:80184244-80184266 CTGATGGAGTAGAAGAGAGAAGG - Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993821626 5:92624677-92624699 CTGACTGGGGAGAATAAAGATGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995200932 5:109424610-109424632 CTTAGTGATTAGAAGAAAGATGG - Intergenic
995575324 5:113525000-113525022 CTAACTGTGAAGAAGAAAGATGG + Exonic
995754940 5:115492973-115492995 CTGACTGTGTAAAAGTAAGGAGG + Intergenic
997028255 5:130091983-130092005 CTGACTGAGAACAAGTGAGAGGG - Intronic
998268470 5:140684930-140684952 CTGACTGAATAGAAGACAGCAGG + Intronic
998611993 5:143699423-143699445 CAGACTCAGTGGAAGGTAGAGGG + Intergenic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999841573 5:155433102-155433124 ATGACTGAGAAAAAGGATGAGGG + Intergenic
999970779 5:156860102-156860124 CAGACTGAGTGGAAAGCAGATGG + Intergenic
1001299190 5:170521882-170521904 CTGAGTGACTACATGGAAGAAGG - Intronic
1001437786 5:171714081-171714103 CTACCTGGGAAGAAGGAAGAGGG + Intergenic
1003068011 6:2919683-2919705 CTGCCAGTGAAGAAGGAAGATGG + Intergenic
1003238856 6:4323816-4323838 CAGAATGAGTAGAAGGGATATGG - Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008990543 6:57596480-57596502 TTGACTGAGAAGAAGCAAGAGGG + Intronic
1009179116 6:60495026-60495048 TTGACTGAGAAGAAGCAAGAGGG + Intergenic
1009633815 6:66236718-66236740 TAGAGTGAGTATAAGGAAGAGGG - Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011211551 6:84960866-84960888 CTGCCTAAGTAGAAGAAAGCTGG + Intergenic
1011338654 6:86287671-86287693 CTTAAAGATTAGAAGGAAGATGG - Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1012951509 6:105522724-105522746 CTGACTGAGTAGCAGAAAGAGGG + Intergenic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1015484537 6:133753550-133753572 AGAAATGAGTAGAAGGAAGAAGG - Intergenic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017058144 6:150456234-150456256 AGGACTGAGGAGAAGGAAGAGGG - Intergenic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1018062768 6:160103542-160103564 GTGATTGAGTGGAAAGAAGATGG - Intronic
1018156227 6:160987724-160987746 TTGGCTGAGTAGTAGGAAGTTGG - Intergenic
1018317722 6:162573493-162573515 CAGACTTAGTAGAAGCAAGCTGG - Intronic
1019463210 7:1172444-1172466 CTGAGTGAGTAGGGGGAAGCTGG - Intergenic
1021301643 7:18980799-18980821 GAGACGGAGGAGAAGGAAGAAGG - Intronic
1021532221 7:21659732-21659754 CTAACTCAGTACCAGGAAGAAGG - Intronic
1022503835 7:30898477-30898499 CTGACGGAGAAGCAGGCAGACGG - Intergenic
1022711570 7:32855615-32855637 CCAGCTGAGTGGAAGGAAGAGGG - Intergenic
1022913085 7:34919343-34919365 CCAGCTGAGTGGAAGGAAGAGGG + Intergenic
1022955167 7:35374067-35374089 AAGACAGAGGAGAAGGAAGAGGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024589882 7:50872254-50872276 CTCACTGAGAAGAATGAAAATGG + Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025291239 7:57726469-57726491 GTGACAGAATTGAAGGAAGAGGG - Intergenic
1025807722 7:64850890-64850912 CAGACTGACTAGAAGAAACATGG - Intergenic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1026645155 7:72161075-72161097 CTGACTCTGTAGAAGGGACATGG - Intronic
1027184891 7:75965155-75965177 CTGACTTGGAAGCAGGAAGATGG + Intronic
1028799158 7:94942132-94942154 CTGACTGAGAAGAGAGAAGTGGG - Intronic
1030165257 7:106548213-106548235 CTGACTGAGGACAAAGAATATGG - Intergenic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030973287 7:116088904-116088926 CTGAGTGAGTACAAGGACTATGG + Intronic
1031152021 7:118065083-118065105 GTGACTGAGTGAAAGGAAGCTGG - Intergenic
1031352407 7:120751032-120751054 GTGACTAAGTTGAAGGAATAGGG - Intergenic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1032041210 7:128563718-128563740 CTCACAAAGTAGAAGGCAGAAGG - Intergenic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1034090173 7:148356748-148356770 CTGACTGAGGTGATGGCAGAAGG - Intronic
1036661029 8:10708847-10708869 CTGGCTGAGGAAAAGGAAAACGG + Intronic
1036745799 8:11408233-11408255 CTCACACAGTAGAAGGTAGAAGG - Intronic
1036806911 8:11841371-11841393 ATGGCTCAGTAGATGGAAGAAGG - Intergenic
1036816059 8:11903616-11903638 CTGGCTGAGTAAAAAGTAGATGG - Intergenic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1038240093 8:25800453-25800475 GAGACTGAGCAGAAGGAATATGG - Intergenic
1039243492 8:35582491-35582513 ACAACTGAGTGGAAGGAAGAAGG - Intronic
1039967605 8:42294538-42294560 TTGACAGAGGAGAAGCAAGAAGG + Intronic
1041731968 8:61071447-61071469 CTGACTGCATAGGAGGAAGTAGG - Intronic
1042082247 8:65067519-65067541 CAGACTAAGTAAAAAGAAGATGG - Intergenic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1042909237 8:73808058-73808080 CTGACTGTGTAAAAGGAAATTGG + Intronic
1043045698 8:75321205-75321227 CTGACTTAGTAGAAGGCAACTGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045524433 8:102929834-102929856 CTGAAAGAGTAAAAGGAAAAAGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1047794032 8:128235692-128235714 CAGACTGAGTAGAAGAGAGAGGG + Intergenic
1047806863 8:128370269-128370291 CTTACAGGGTAGAAGCAAGATGG - Intergenic
1048184441 8:132226726-132226748 CTGACTGAGCAGAAGAAAATGGG + Intronic
1049252356 8:141596150-141596172 CTCTCTAAGTAGAAGGAAGCAGG + Intergenic
1049629163 8:143642909-143642931 CTGAATGAGTAACTGGAAGAAGG - Intronic
1049992196 9:1000537-1000559 CTCAGTGAGTAGAAGGGATAGGG + Intergenic
1051817304 9:21122901-21122923 CTGGCTGAATAGAAGATAGATGG + Intergenic
1051877252 9:21805688-21805710 CTCACTTAGTAGAGGGAATAAGG - Intronic
1052408691 9:28095284-28095306 CTGACTGAGTAGTTGGGATACGG - Intronic
1052998869 9:34566306-34566328 CTGTCAGAGAAGAAGGAAGCAGG + Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1057307889 9:93922756-93922778 AAGACAGAGAAGAAGGAAGAGGG + Intergenic
1058157019 9:101527259-101527281 CTGACTCAGAAGAAAGAAAAAGG - Intronic
1058425408 9:104871368-104871390 CTTACTGAGAAGAGGGAAGGTGG + Intronic
1059152613 9:111963153-111963175 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1059388419 9:113983520-113983542 CTGACTGAGTTCACAGAAGATGG - Intronic
1059858949 9:118435288-118435310 ATGAATGGGTAGAAGGATGATGG - Intergenic
1060295535 9:122340672-122340694 GTGCCTGAGTATGAGGAAGATGG + Intergenic
1061989807 9:134152728-134152750 ATGACAGACTAGAGGGAAGAAGG - Intronic
1062057931 9:134478263-134478285 GTGACTGGGTCCAAGGAAGAAGG - Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1187832541 X:23397577-23397599 CTGAGGGAGTAAAAGGCAGAAGG - Exonic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1189925528 X:45949836-45949858 CTGACAGAATTGAAGGGAGAAGG - Intergenic
1190931342 X:54951534-54951556 CTGACAGAGGAGACAGAAGAGGG + Intronic
1191009447 X:55745544-55745566 CAGCCTGTGTAGAAGAAAGATGG - Intronic
1192399136 X:70816822-70816844 GAGTCAGAGTAGAAGGAAGAGGG + Intronic
1192589723 X:72349941-72349963 ATGGCAGAGTTGAAGGAAGAAGG + Intronic
1192719713 X:73679795-73679817 CTGGCTGAGGAGAAAAAAGAAGG - Intronic
1193314069 X:80043592-80043614 CTGACTGAATAGAACTGAGAGGG - Intergenic
1193588371 X:83356247-83356269 ATTACAGAGTAGAAGAAAGATGG - Intergenic
1195205462 X:102595426-102595448 CTGGATGGGTAGAAGGGAGAGGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1195940811 X:110166460-110166482 GTGAGTGAGTTGAAGGAAGCAGG + Intronic
1195994587 X:110719103-110719125 TTGACTGGATAGAAGGAAAAAGG + Intronic
1196546754 X:116972497-116972519 TTGTCAGAGTAGGAGGAAGAGGG - Intergenic
1199664041 X:150082575-150082597 GTGACTGAATAGATGGATGAGGG + Intergenic