ID: 1101198447

View in Genome Browser
Species Human (GRCh38)
Location 12:102409565-102409587
Sequence CACTTGTATGAGATGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101198447_1101198452 -8 Left 1101198447 12:102409565-102409587 CCCCCTGCCATCTCATACAAGTG 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1101198452 12:102409580-102409602 TACAAGTGACAGATTGTATATGG 0: 1
1: 0
2: 0
3: 12
4: 139
1101198447_1101198453 16 Left 1101198447 12:102409565-102409587 CCCCCTGCCATCTCATACAAGTG 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1101198453 12:102409604-102409626 AAATATCAACTAAGAAATGCAGG 0: 1
1: 0
2: 0
3: 45
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101198447 Original CRISPR CACTTGTATGAGATGGCAGG GGG (reversed) Intronic
902672322 1:17983386-17983408 CAAATGTATGAGATGGCTGAAGG - Intergenic
904841324 1:33373678-33373700 AACTGGGAAGAGATGGCAGGAGG - Intronic
906565462 1:46797957-46797979 CACTAGTAGGAGATGGGAGATGG + Intronic
907978849 1:59460656-59460678 CAGCTGTATGAGATGTCAGTCGG - Intronic
908277512 1:62490812-62490834 CACTTGTCTAAGCTAGCAGGGGG - Intronic
908916412 1:69131309-69131331 CAACTGTATGAGTTGTCAGGTGG - Intergenic
911128939 1:94369684-94369706 CACCTGTATGAGGTGTCAGTTGG + Intergenic
911339212 1:96617250-96617272 CACCTGTATGAGGTGTCAGTTGG + Intergenic
913051057 1:115116695-115116717 CACTTCTAAGAGCTGCCAGGTGG - Intergenic
913607454 1:120478908-120478930 CACTTGTATGAGGTGTCTGTCGG - Intergenic
914441479 1:147711454-147711476 CACCTGTATGAGGTGTCAGTTGG + Intergenic
914583738 1:149042926-149042948 CACTTGTATGAGGTGTCTGTCGG + Intronic
914938325 1:152000211-152000233 CACCTGTAGGAGAAGACAGGTGG - Intergenic
916534546 1:165691117-165691139 CACCTGTATGAGGTGTCAGTCGG - Intronic
917192476 1:172432343-172432365 CACCTGTATGAGGTGTCAGTCGG - Intronic
917308738 1:173655507-173655529 CACCTGTATGAGGTGTCAGTCGG + Intronic
917590235 1:176468967-176468989 AACTTGTAAGAGCTGGTAGGTGG + Intronic
917619473 1:176781289-176781311 CACTTTTAGGAGTTAGCAGGTGG + Intronic
917703082 1:177600903-177600925 CACTGGTCTGACATGGCATGGGG - Intergenic
917723620 1:177809749-177809771 CACTTGAAGGAGATGGCTGTTGG - Intergenic
918890287 1:190257874-190257896 CACCTGTATGAGGTGTCAGTTGG + Intronic
919140295 1:193562076-193562098 CAGTTGTCTTACATGGCAGGGGG + Intergenic
920611932 1:207449171-207449193 CACTTTGAGGACATGGCAGGAGG + Intergenic
921417129 1:214901772-214901794 CACTTCTATGGGGAGGCAGGAGG - Intergenic
923035990 1:230285457-230285479 CACTTCCATGACATGGGAGGAGG - Intergenic
923069235 1:230547685-230547707 CACTTGTATGAGATATCTAGAGG - Intergenic
1063196144 10:3745570-3745592 CACTTCTGAGAGATGGGAGGAGG - Intergenic
1068821177 10:61378738-61378760 CAGTTGTATGAGGTGTCAGTTGG + Intergenic
1069095765 10:64258052-64258074 CACTTGTATTATATGACAGGTGG + Intergenic
1069105582 10:64379919-64379941 CACTAGAAAGAGATGGTAGGAGG + Intergenic
1071983240 10:91024739-91024761 CTCGTGTAAGAGATTGCAGGGGG - Intergenic
1075571955 10:123552630-123552652 CAGTTGTATGAGGAGGCTGGGGG + Intergenic
1075946592 10:126438797-126438819 CACTTTTAAGAGATGCCATGTGG - Intronic
1077710538 11:4532155-4532177 CAGCTGTATGAGATGTCAGTTGG - Intergenic
1079152987 11:17918189-17918211 CACTTGTACCAGCAGGCAGGTGG - Intronic
1080591816 11:33730895-33730917 TACTTGTCTGAAATGGCAGGCGG - Intronic
1080873046 11:36253523-36253545 CACTTGTTTGAGATGCATGGTGG + Intergenic
1081080330 11:38732744-38732766 CACTTGTCTTACATGGCAGCAGG + Intergenic
1084251829 11:67905547-67905569 CACCATCATGAGATGGCAGGAGG - Intergenic
1085767425 11:79295346-79295368 CCCTTGTCTGACATGGGAGGAGG - Intronic
1086769472 11:90744483-90744505 CACTTCTGTGAGGTGGCAGAAGG - Intergenic
1092957428 12:13563204-13563226 CACATGTTTGAGATGTCAGCTGG - Exonic
1095802642 12:46284239-46284261 CTCCTGTATGAGGTGGCAGTCGG - Intergenic
1097148583 12:56958971-56958993 CACCTGTATGAGATGTCAGTCGG - Intronic
1099732705 12:86525963-86525985 CACTTGTTGGCTATGGCAGGGGG + Intronic
1100748704 12:97673310-97673332 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1101198447 12:102409565-102409587 CACTTGTATGAGATGGCAGGGGG - Intronic
1101213481 12:102558227-102558249 TATTTGTATGAGATGGAACGAGG - Intergenic
1101516586 12:105441352-105441374 CACTTGGATCACAAGGCAGGTGG - Intergenic
1103190707 12:118999360-118999382 CACCTGAATGTCATGGCAGGAGG + Intronic
1107214184 13:37896357-37896379 AACTTGTATGTGATGGTATGAGG + Intergenic
1108884493 13:55163685-55163707 CACATGAATGAGAAGGCAGAAGG + Intergenic
1109651690 13:65336250-65336272 CAGATGTATGAGCTGCCAGGGGG + Intergenic
1111181824 13:84679058-84679080 CAATTGCAGGAGATGGAAGGTGG + Intergenic
1113147672 13:107226225-107226247 CAATTGTATGTTATGGAAGGAGG + Intronic
1116634508 14:47377968-47377990 CAGCTGTATGAGATGTCAGTTGG - Intronic
1117796980 14:59405129-59405151 CACCTGTATGAGGTGTCAGTTGG + Intergenic
1118537409 14:66783226-66783248 TACTTCTGTGGGATGGCAGGGGG - Intronic
1121676301 14:95755976-95755998 GACTTGTAAGAGAAGGCAGTGGG - Intergenic
1124935557 15:34166690-34166712 CACCTGTATGAGGTGTCAGTCGG - Intronic
1125362536 15:38879280-38879302 CACCTGCCTGAGATGGCTGGAGG + Intergenic
1128926892 15:71664722-71664744 CACTTGTAAGTGATAGCATGTGG + Intronic
1130936206 15:88472887-88472909 AACTTGTGTAAGATGGCAGGTGG - Intronic
1132349464 15:101130444-101130466 CACTTGGATGAGATAACTGGAGG + Intergenic
1138807202 16:60104259-60104281 TAGATGTATGAGATGGTAGGAGG - Intergenic
1138861764 16:60766576-60766598 CCCTTGTGTGTGAGGGCAGGGGG + Intergenic
1139684543 16:68592621-68592643 CAATTATATGACATGTCAGGAGG - Intergenic
1144788581 17:17845264-17845286 GACCTGTATGGGCTGGCAGGAGG - Intronic
1144839832 17:18179070-18179092 AACTTGGATCAGATAGCAGGAGG + Exonic
1145787171 17:27601678-27601700 CACTGCTAGGAGATGGCAGAAGG + Intronic
1148671370 17:49413029-49413051 CTGTGGTATGAAATGGCAGGAGG + Intronic
1155659233 18:28228388-28228410 CACCTGTATGAGTTGTCAGTTGG + Intergenic
1156180793 18:34601652-34601674 CATTAGTATCAGATCGCAGGTGG - Intronic
1156801842 18:41124572-41124594 CTCTTGTATGATTTGGCAAGAGG - Intergenic
1157037320 18:43990581-43990603 CACTTGTATGTGAGGACATGTGG + Intergenic
1159780228 18:72652378-72652400 CAATTGTGTGAGGTGGGAGGTGG + Intergenic
1165973106 19:39649919-39649941 CACCTGTATGAGGTGTCAGTCGG - Intergenic
1166176782 19:41078829-41078851 CACTGGCAAGAGATGGAAGGGGG + Intergenic
926657588 2:15425722-15425744 CAGATGTAAGAGATGCCAGGAGG - Intronic
926702945 2:15816141-15816163 CACATGTATCAGTTGGCAGGGGG - Intergenic
928982401 2:37149887-37149909 CACTTCTATAAAATGTCAGGTGG - Intronic
929224149 2:39495697-39495719 CACCTATATGAGGTAGCAGGAGG - Intergenic
930267498 2:49217043-49217065 GACTTGTAAGAGATAGCACGGGG - Intergenic
931254298 2:60556568-60556590 CACTTGTTTCAGATTCCAGGGGG + Intergenic
933862292 2:86482296-86482318 CACTTCTATGAGTTGTCAAGTGG + Intronic
933900916 2:86849458-86849480 CACTTCTATGAGATGCCCTGGGG + Intronic
935779626 2:106499773-106499795 CACTTCTATGAGATGCCCTGGGG - Intergenic
936734513 2:115425213-115425235 AACTTGCATGAGGTGGCAAGGGG + Intronic
936806369 2:116337220-116337242 CACCTGTATGAGGTGTCAGTCGG + Intergenic
939730893 2:145783116-145783138 CAGCTGTATGAGATGTCAGTCGG - Intergenic
939859984 2:147407822-147407844 CACCTGCATGAGATTGCATGTGG - Intergenic
939974844 2:148705581-148705603 CAGTTGTATGAGGTGTCAGTCGG - Intronic
941984914 2:171500649-171500671 CACTAGTAAGAGATGTCAGTTGG + Intergenic
943051248 2:182915985-182916007 CACTTGTCTGGGATGTCAGGGGG - Intronic
944837091 2:203590478-203590500 CTCTTGTCTGAGATGGGTGGGGG - Intergenic
944938216 2:204592127-204592149 CCTTTGTAGGAGATGGCTGGAGG + Intronic
944974840 2:205038093-205038115 CATTTTTAGGTGATGGCAGGTGG + Intronic
945672863 2:212822911-212822933 CACTGGCAAGAGATTGCAGGAGG - Intergenic
1168833299 20:859257-859279 CACATGTATAAGATGGGAGTAGG + Intergenic
1169360802 20:4947175-4947197 CACCAGAATGAGATGGCAGCAGG + Intronic
1170358703 20:15520747-15520769 CACATGTATGAAACAGCAGGTGG + Intronic
1171443470 20:25186241-25186263 CACCTGTATGAGATGTCAGTTGG + Intergenic
1172013257 20:31858558-31858580 CTCTTTTATGGGGTGGCAGGAGG + Intronic
1174646247 20:52088389-52088411 CACCCGTGTGAGATCGCAGGTGG + Intronic
1176363867 21:6020799-6020821 CCCGTGTATGAGGGGGCAGGAGG + Intergenic
1177111550 21:17034857-17034879 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1177424564 21:20905644-20905666 TACTTGTGTGAGGTGGAAGGAGG - Intergenic
1179759651 21:43517746-43517768 CCCGTGTATGAGGGGGCAGGAGG - Intergenic
1180032264 21:45220575-45220597 CACTTGTCTGACAGGGCAGGTGG - Intronic
1180037688 21:45258151-45258173 CTCCTGTCTGAGATGGCAGAAGG - Intergenic
1180724882 22:17939433-17939455 CACCTTTGTGAGAGGGCAGGAGG - Intronic
1181087847 22:20451062-20451084 CACTTGTAAGAGATGTTATGTGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
949816835 3:8068008-8068030 CAGTTGTATGAGGTGTCAGTCGG + Intergenic
951795290 3:26532172-26532194 CACTTGTATGACAAGTCTGGTGG + Intergenic
952517634 3:34121982-34122004 CACCTGTATGAGGTGTCAGTTGG + Intergenic
952826486 3:37529377-37529399 GACTTGTTGGAGGTGGCAGGGGG + Intronic
953653057 3:44823403-44823425 CACCTGTATGAGGTGTCAGTCGG + Intronic
953915646 3:46919175-46919197 CTTTTGTATGGGATGCCAGGAGG + Intergenic
954016843 3:47700606-47700628 CACTTGAAGGAGGTTGCAGGAGG - Intronic
956622884 3:71238778-71238800 CACTTGTAAGTGCTTGCAGGTGG - Intronic
958413909 3:93852174-93852196 CACCTGTATGAGGTGTCAGTTGG + Intergenic
961571496 3:127802440-127802462 CACCTGTAGGAGATTACAGGAGG - Intronic
961985290 3:131125555-131125577 CAACTGTAAGAGATGGCAGAAGG - Intronic
963718774 3:148835590-148835612 CACTTGCATAAGAGGGAAGGAGG + Intronic
964214417 3:154263324-154263346 CACCTGTATGAGGTGTCAGTAGG - Intergenic
965011862 3:163103794-163103816 CATTTGTATGTGTTGGCAGTAGG + Intergenic
965200855 3:165655876-165655898 CACCTGTATGAGGTGTCAGTGGG - Intergenic
965732816 3:171790716-171790738 CCCTTGTCTGAGATGGCTGCTGG - Intronic
969889905 4:10250133-10250155 CTCTTCTATGAGATGGAAGCAGG + Intergenic
971819567 4:31533674-31533696 CATGTTTTTGAGATGGCAGGCGG - Intergenic
974144363 4:57928359-57928381 CATTTGTTTGAGATGGAAGTTGG - Intergenic
975520936 4:75300374-75300396 CACCTGTATGAGGTGTCAGTTGG + Intergenic
977194781 4:94045202-94045224 CACCTGTATGAGGTGTCAGTCGG - Intergenic
980610438 4:135153687-135153709 GACTTGTATGAGATGACAGATGG - Intergenic
981445874 4:144837451-144837473 CACCTGTATGAGGTGTCAGTCGG - Intergenic
986221271 5:5770955-5770977 CACTTGAATTAGATGACATGGGG - Intergenic
986244349 5:5991925-5991947 CACCTGTGTGGCATGGCAGGGGG + Intergenic
986454971 5:7909059-7909081 CAGTAGTATGAGAAGGCTGGGGG + Intergenic
986480764 5:8184685-8184707 CACTTGGATGAGAGGGCTGGTGG - Intergenic
987460842 5:18207828-18207850 GACTTGGATGAGATTGAAGGAGG + Intergenic
989345234 5:40422601-40422623 CACCTGTATGAGGTGTCAGTTGG + Intergenic
991765955 5:69979525-69979547 TACTTGTATAATATGGCAGATGG + Intergenic
991781367 5:70138637-70138659 TACTTGTATAATATGGCAGATGG - Intergenic
991845191 5:70854596-70854618 TACTTGTATAATATGGCAGATGG + Intergenic
991873813 5:71138951-71138973 TACTTGTATAATATGGCAGATGG - Intergenic
992162387 5:74015985-74016007 CTCTGGTATGACATGGGAGGTGG - Intergenic
993497371 5:88622860-88622882 CACCTGTATGAGGTGTCAGTCGG + Intergenic
993627092 5:90239003-90239025 CAGTTGTATGAGGTGTCAGTCGG - Intergenic
998387375 5:141765282-141765304 CACTGGGAAGAGCTGGCAGGAGG + Intergenic
1001833649 5:174811341-174811363 CACTTGGAAGATATGGCAGCTGG - Intergenic
1002276997 5:178110460-178110482 CACTTGCAAGAAATGGCATGAGG - Intergenic
1002790980 6:437211-437233 CACTTGTATGTGGTGGCAAATGG - Intergenic
1005032647 6:21525700-21525722 CACTTGTATGTTATAGCATGAGG + Intergenic
1007399785 6:41597284-41597306 CTCTTGTATGAGAAAGCAAGGGG - Intronic
1007558258 6:42783727-42783749 CACTTGTTTGTGATGGAAGAAGG + Intronic
1007586271 6:42991922-42991944 CACAGGTATGAGATGGCAGCAGG + Intronic
1008053816 6:46926438-46926460 CTCTTCTAGGAGATGGCAGAGGG - Intronic
1008436801 6:51485783-51485805 CAGTTGTATGAGGTGTCAGTTGG + Intergenic
1010683962 6:78830100-78830122 AACTTGTATGAGATGCAAAGAGG - Intergenic
1011417807 6:87140412-87140434 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1012406654 6:98908375-98908397 CACTTCTATGAAACGGAAGGAGG - Intronic
1012725803 6:102808828-102808850 CACTTGTATGAGGTGTCAGTCGG + Intergenic
1014907171 6:127043975-127043997 CACCTGTATGAGGTGTCAGCCGG - Intergenic
1014961643 6:127694039-127694061 CACTTTTATAAAATGTCAGGTGG + Intergenic
1014991861 6:128089768-128089790 CATTTGTATAAGGTGGCAGATGG + Exonic
1018469013 6:164080167-164080189 CAGTTGTTTGGGATGGCAGAGGG + Intergenic
1022867050 7:34432055-34432077 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1026883131 7:73919989-73920011 CCCTTGTGTGAGGTGGGAGGAGG + Intergenic
1028526381 7:91791202-91791224 CACCTGTATGAGTTGTCAGTCGG - Intronic
1029091053 7:98048704-98048726 GAGTTGTCTGAGCTGGCAGGTGG + Intergenic
1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG + Intergenic
1033608670 7:142945240-142945262 GATTTACATGAGATGGCAGGTGG - Intronic
1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG + Intronic
1034198492 7:149266011-149266033 CACTTGTTTGAGACTGCACGTGG + Intronic
1034208906 7:149345220-149345242 CAGCTGTATGAGATGTCAGTTGG + Intergenic
1034715293 7:153236067-153236089 CACTTATGTGACTTGGCAGGAGG + Intergenic
1036135796 8:6160518-6160540 AACATGCATGAGATGGCGGGCGG - Intergenic
1036404752 8:8444626-8444648 CACTTGTGTTAGATAGCAGGCGG + Intergenic
1036651023 8:10644122-10644144 CAGTTGCTTAAGATGGCAGGGGG - Intronic
1037557584 8:20040708-20040730 CAGGTGTATGAGATGTCAGTTGG + Intergenic
1040087786 8:43364249-43364271 CACCTGTAGGAGGTGGCTGGAGG - Intergenic
1040621987 8:49101611-49101633 CACTTGTAGGAGGTGGAAGAGGG - Intergenic
1040763844 8:50882144-50882166 CATTTTCATGAGATGGAAGGTGG + Intergenic
1042225185 8:66509791-66509813 TGCTTGTATGAGGGGGCAGGAGG - Intronic
1043425627 8:80145768-80145790 CACTTGTCCGAGATGAAAGGAGG + Intronic
1044125840 8:88457303-88457325 CACTTGTAAGAAGTGGCTGGAGG - Intergenic
1045252166 8:100491386-100491408 ATCTTTTATGAGATGACAGGAGG + Intergenic
1048390523 8:133959264-133959286 AACTTTAATGAGATGTCAGGAGG + Intergenic
1050387057 9:5101629-5101651 CACCTGTATGAGGTGTCAGTTGG - Intronic
1056404074 9:86257608-86257630 CGCTTGTCTGACATGGCAGCTGG + Intronic
1056700946 9:88907681-88907703 CAGCTGTATGAGATGTCAGTAGG - Intergenic
1062099008 9:134718343-134718365 CACTTTAATGACCTGGCAGGGGG + Intronic
1185806283 X:3060041-3060063 CACCTGTATGAGTTGTCAGTTGG - Intronic
1187172799 X:16868954-16868976 CCCTTGCATGAGGTGGCAGGTGG - Intronic
1188327415 X:28822647-28822669 GACTTGTGGGAGATGGCTGGTGG + Intronic
1189176946 X:38967034-38967056 ATTTTGTATGAGATGACAGGAGG + Intergenic
1190683364 X:52848944-52848966 CATCTGTATGAGATGTCAGTTGG + Intergenic
1191037629 X:56044226-56044248 CACCTGTATATGATGGCTGGAGG + Intergenic
1192406479 X:70890958-70890980 CGCCTGTATGAGATGTCAGTCGG - Intronic
1195464494 X:105165355-105165377 GACTTGTAAGAGATTGCATGTGG - Intronic
1197835092 X:130685947-130685969 CACTTGGATGAAATGTCAGGTGG + Intronic
1198330156 X:135615391-135615413 AACTTTTCTGAGATGGCAGTAGG - Intergenic
1198336773 X:135673609-135673631 AACTTTTCTGAGATGGCAGTGGG + Intergenic
1198362820 X:135912854-135912876 AACTTTTCTGAGATGGCAGTGGG - Exonic
1198366046 X:135941149-135941171 CAGTTGTATGAGGTGTCAGTCGG + Intergenic
1198847773 X:140931248-140931270 CAGTTTTATGCGATGGCTGGAGG - Intergenic
1199449965 X:147968152-147968174 CAGCTGTATGAGATGTCAGTCGG - Intergenic
1199544613 X:148994887-148994909 CACCTGCATGAGTTGGCAGGTGG + Exonic
1200650306 Y:5832988-5833010 CGCTTGTATGAGTTGTCAGTCGG - Intergenic
1201314385 Y:12629488-12629510 CACCTGTATGAGGTGTCAGTAGG + Intergenic
1201356108 Y:13098723-13098745 CACTTTTATGAGGAGGCTGGAGG + Intergenic
1202054889 Y:20819209-20819231 CACCTGTATGAGGTGTCAGCTGG - Intergenic
1202253903 Y:22901385-22901407 CAGTTGTGTGAGGTGTCAGGTGG + Intergenic
1202406893 Y:24535134-24535156 CAGTTGTGTGAGGTGTCAGGTGG + Intergenic
1202463888 Y:25134947-25134969 CAGTTGTGTGAGGTGTCAGGTGG - Intergenic