ID: 1101200109

View in Genome Browser
Species Human (GRCh38)
Location 12:102426910-102426932
Sequence GTGAATAAAAAGAATGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 456}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101200109_1101200115 30 Left 1101200109 12:102426910-102426932 CCTTTGACATTCTTTTTATTCAC 0: 1
1: 0
2: 2
3: 47
4: 456
Right 1101200115 12:102426963-102426985 TGTGGAGTTTACGGTAGGCTAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1101200109_1101200110 -3 Left 1101200109 12:102426910-102426932 CCTTTGACATTCTTTTTATTCAC 0: 1
1: 0
2: 2
3: 47
4: 456
Right 1101200110 12:102426930-102426952 CACTGATGTACTTTTGAGCAAGG 0: 1
1: 0
2: 1
3: 9
4: 143
1101200109_1101200112 21 Left 1101200109 12:102426910-102426932 CCTTTGACATTCTTTTTATTCAC 0: 1
1: 0
2: 2
3: 47
4: 456
Right 1101200112 12:102426954-102426976 TTATGCCACTGTGGAGTTTACGG 0: 1
1: 0
2: 0
3: 11
4: 173
1101200109_1101200111 12 Left 1101200109 12:102426910-102426932 CCTTTGACATTCTTTTTATTCAC 0: 1
1: 0
2: 2
3: 47
4: 456
Right 1101200111 12:102426945-102426967 GAGCAAGGCTTATGCCACTGTGG 0: 1
1: 0
2: 2
3: 13
4: 118
1101200109_1101200113 25 Left 1101200109 12:102426910-102426932 CCTTTGACATTCTTTTTATTCAC 0: 1
1: 0
2: 2
3: 47
4: 456
Right 1101200113 12:102426958-102426980 GCCACTGTGGAGTTTACGGTAGG 0: 1
1: 0
2: 1
3: 4
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101200109 Original CRISPR GTGAATAAAAAGAATGTCAA AGG (reversed) Intronic
900030795 1:371235-371257 AAGAATAAAATGAATGTCCATGG - Intergenic
900051410 1:599909-599931 AAGAATAAAATGAATGTCCATGG - Intergenic
901108637 1:6777489-6777511 TTGAAGAAAAATAATGTGAAAGG - Intergenic
902445365 1:16459939-16459961 GTTAATAAAAGGAATGTCAGAGG - Exonic
903828549 1:26161580-26161602 GTGAACAAAGAGAACGCCAAGGG + Exonic
906739401 1:48167402-48167424 GTGAAAAAAAAGAATGAAGAGGG - Intergenic
906866036 1:49421189-49421211 GAGCATAAAATGAATGTAAAAGG + Intronic
907791512 1:57670077-57670099 CTGAATAAAAATAATTTCAGTGG - Intronic
908348010 1:63255512-63255534 GTGAATAAAAATAATGCCATAGG + Intergenic
908409983 1:63854162-63854184 GTGAATAAAAAAAAATTCATTGG - Intronic
908470269 1:64437315-64437337 AGGTATAAAAAGAAGGTCAATGG + Intergenic
908998045 1:70183033-70183055 GTAGATAAAATGAATGGCAAAGG - Intronic
908999717 1:70203963-70203985 GTGAATAAACAGCATTTCATAGG - Intronic
909324112 1:74327188-74327210 GTAAATAAAAATATTGTAAAGGG + Intronic
909503165 1:76357999-76358021 GTTAATAAAAATAATGAAAAAGG - Intronic
909649800 1:77961341-77961363 GTTAATAAAAAGAACTTTAAAGG - Intronic
909721596 1:78777421-78777443 GTAAAAAGAAAAAATGTCAAGGG - Intergenic
910315173 1:85874617-85874639 GTGTATTAAAAGAGTTTCAAGGG + Intronic
915099402 1:153488119-153488141 GGGAATAAAAAGAAATTGAATGG + Intergenic
915617297 1:157048787-157048809 ATGAAGAAAATGAACGTCAATGG + Intergenic
915757925 1:158280850-158280872 GAGAAAAAAAAGACTGTTAATGG - Intergenic
916011554 1:160710927-160710949 GGGAATAGCAAGAAAGTCAAAGG + Intronic
916251261 1:162740600-162740622 GTGAAGAAAAAGTATGCAAAAGG - Intronic
916732386 1:167578275-167578297 GTGACAAAAATGGATGTCAAAGG + Intergenic
916878553 1:168997023-168997045 ATGAAGAAAAAAAATGTTAAGGG - Intergenic
917004928 1:170404173-170404195 ATTTATAAAAAGAAAGTCAAAGG - Intergenic
917300910 1:173573200-173573222 GTAAATAAAATGAATATGAAAGG + Exonic
917384762 1:174459910-174459932 GTGTATTAAAAGATTGTAAATGG + Intronic
918348559 1:183629775-183629797 GTGAATATAATTAATGCCAATGG - Intronic
918390444 1:184054109-184054131 GTGATTAAAAACCATGTAAATGG - Intronic
918599197 1:186334019-186334041 ATGAATAACAAGAGTGTCATGGG + Intronic
919191031 1:194219279-194219301 CTGAATAATCAGACTGTCAAAGG + Intergenic
920320727 1:205120386-205120408 GTGGATAAAGAGAATGCCAGGGG - Intronic
921410291 1:214829035-214829057 GTGAATAAATAGGAAGTGAAGGG - Intergenic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
921704697 1:218309092-218309114 GTAGAAAAAAAGAAAGTCAAGGG - Intronic
923243954 1:232112806-232112828 ATGGATAAGAAGACTGTCAAAGG - Intergenic
923252262 1:232188362-232188384 GTGAACACCAAGAATGTTAAAGG + Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924837197 1:247662596-247662618 GAGAAAAAAAATAATGTAAAAGG - Intergenic
1063799580 10:9558098-9558120 TTAAAGAAAAAGAATGACAAGGG + Intergenic
1064233587 10:13552085-13552107 TTTAAAAAAAAGAAAGTCAAAGG + Intergenic
1064399541 10:15010181-15010203 GTGATTACAAATAATATCAAAGG - Intergenic
1064459357 10:15518876-15518898 GTGCTTATAAAAAATGTCAAAGG + Intronic
1064788483 10:18927028-18927050 GTGCATAAAAGAAGTGTCAAGGG + Intergenic
1064801466 10:19078820-19078842 ATAAATAAAAAGAATTACAAGGG - Intronic
1064905719 10:20343469-20343491 GAGAAGAAAAAGAATATAAAAGG - Intergenic
1065356734 10:24849670-24849692 GTTAATATAAAGAGTATCAAAGG - Exonic
1065662205 10:28017603-28017625 GTGAAAAATAAGAATATAAAAGG + Intergenic
1065745825 10:28840834-28840856 TGGAATAAAAATAATCTCAATGG - Intergenic
1065978475 10:30865449-30865471 ATGAAGAAAAAAAATGACAAAGG + Intronic
1068193510 10:53685358-53685380 GAGAATGAAAAGACAGTCAATGG + Intergenic
1069250928 10:66265987-66266009 GTGAATAAAAAGACAATAAATGG + Intronic
1069302024 10:66919960-66919982 GCGAATACACAGAATATCAATGG + Intronic
1071163201 10:82776595-82776617 GTGAAGAAAAAGAAAGTCTATGG - Intronic
1071226936 10:83541385-83541407 GAGAATAAAGTGAATGTCATTGG - Intergenic
1071317274 10:84414572-84414594 ATGAAAAAAAAAAATGTTAAGGG - Intronic
1071865471 10:89725459-89725481 TTAAATAAAAAGAATTTTAAAGG + Intronic
1073006153 10:100326414-100326436 GTGAATAGAAAGAAAGTCTCTGG - Intronic
1073716448 10:106113689-106113711 TTTAAAAAAAAGATTGTCAAGGG - Intergenic
1073783906 10:106867156-106867178 ATGGAAAAAAAGAATGTTAAAGG + Intronic
1074401863 10:113148083-113148105 CTGAATAGAATGAATATCAAAGG - Intronic
1075134463 10:119771217-119771239 GTGAAAAAAAACAATCACAAAGG - Intronic
1075334628 10:121599220-121599242 ATTAATAAAAAGAAATTCAAAGG + Intergenic
1075751444 10:124775506-124775528 GAGACTAAAAATAATTTCAAAGG + Intronic
1076143684 10:128099414-128099436 GTCAAGAAAAACAATGTTAATGG - Intronic
1076352895 10:129831052-129831074 ATGAATAACAACAATATCAAAGG - Intergenic
1079377523 11:19906846-19906868 GTGAATACCAAGAATCCCAAAGG - Intronic
1079886553 11:25997078-25997100 CTGAATAAAGAGAATGTTAGTGG + Intergenic
1079940602 11:26675540-26675562 GTGAGAAAAGAGAAGGTCAAAGG + Intronic
1081313341 11:41600604-41600626 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
1081717439 11:45260466-45260488 GTGAAGAACAAGAATGTCTGGGG + Intronic
1082199644 11:49349792-49349814 GGGAAAAAAAAGAAGGACAAAGG - Intergenic
1082706727 11:56501512-56501534 GGGAATGAAAAGAAAGACAAAGG - Intergenic
1082968435 11:58993080-58993102 GTGAATAACAAAAATGTACAAGG - Intronic
1083090852 11:60199061-60199083 ATCAATACAATGAATGTCAAAGG + Intergenic
1085241919 11:75063889-75063911 ATGAGTAAAAACAAAGTCAAAGG - Intergenic
1085815841 11:79736188-79736210 GCAAATAAAGAGAATGTCAGTGG - Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086868115 11:92004489-92004511 GTCAATAAAAAAACTGGCAATGG + Intergenic
1087320867 11:96656850-96656872 GTGAATAAATAGAATGCCGCAGG + Intergenic
1087384546 11:97453774-97453796 CTGAATAAAAAGAATGTTTCAGG + Intergenic
1088002143 11:104895215-104895237 AACAAGAAAAAGAATGTCAATGG + Intergenic
1088452019 11:109992423-109992445 ATGAATAAATAAAATGTCAAGGG + Intergenic
1088693498 11:112347310-112347332 GGGAAGAAGAAGAATGGCAATGG - Intergenic
1089311981 11:117564362-117564384 GTGAATAAAAACAATAACAAAGG - Intronic
1089558604 11:119331240-119331262 TTGATTTAAAAGACTGTCAAGGG - Intergenic
1090035825 11:123248628-123248650 GAAAATAAAAAGGATGTTAAAGG - Intergenic
1090592668 11:128289525-128289547 GTAAATGAAAAGATTGTCACTGG - Intergenic
1091874386 12:3921511-3921533 GAAAATAAAAAGAATGTTCAAGG + Intergenic
1092452229 12:8613682-8613704 GTGAATAAATAGAATGCATATGG - Intergenic
1092969872 12:13683240-13683262 GTGAATAGAAAGAAAATAAAGGG + Intronic
1093216938 12:16373638-16373660 TTGAATAAAAAGCATATAAATGG + Intronic
1093255930 12:16868337-16868359 GAGAACAAATAGAAAGTCAAAGG - Intergenic
1093257384 12:16886789-16886811 GTGAAGAAAAAAATTGTCACAGG - Intergenic
1093312693 12:17609715-17609737 GGGAAAAAAAAGAATTTAAAAGG + Intergenic
1093511089 12:19929331-19929353 TTGAAAAAAAAAAATGCCAAGGG - Intergenic
1094198917 12:27778402-27778424 GAGAACTAAAAGAAAGTCAAAGG - Intergenic
1095118694 12:38386731-38386753 GGCAATAAAAAGAATAACAAAGG + Intergenic
1095129679 12:38524907-38524929 GTGAATAAAAAGGATCAGAAAGG - Intergenic
1095440581 12:42235759-42235781 GTAAAAAAAAAAAATGTCAGGGG + Intronic
1095716624 12:45353245-45353267 GTGATAAAAATGAATGACAAGGG - Intronic
1096118109 12:49068102-49068124 AAGAATAAAAAGAATGTAAGGGG - Intronic
1097349311 12:58530655-58530677 GTGTAAAAAAAGAAAGTGAAGGG + Intergenic
1097417884 12:59336107-59336129 GTGAATATAAACAGTGTCTAAGG + Intergenic
1097571093 12:61333657-61333679 ATGACAAAAAAGAGTGTCAATGG + Intergenic
1097761651 12:63472672-63472694 ATGAACAAAAAAAATCTCAAGGG - Intergenic
1097943914 12:65345314-65345336 GTGAAAAAAATGAGTGTCATTGG + Intronic
1098047831 12:66420171-66420193 GAAAATAAAAAGAAAGTTAATGG + Intronic
1098123483 12:67266949-67266971 GAGAAAATAATGAATGTCAAAGG - Intergenic
1098363817 12:69681517-69681539 TTCAGTAAAAAAAATGTCAAAGG + Intronic
1098895428 12:76054781-76054803 GTGGATAAAAATAATGCCAAGGG - Intronic
1100175678 12:92028329-92028351 GTGAATAATAGGAATGCAAATGG - Intronic
1100602051 12:96120482-96120504 GTAAATAAGAAGGATGTTAATGG + Intergenic
1100682680 12:96945795-96945817 CTGAATAAAACGAATTTGAATGG - Exonic
1100741067 12:97594114-97594136 GTTAATTAAAAGGAGGTCAAAGG + Intergenic
1101200109 12:102426910-102426932 GTGAATAAAAAGAATGTCAAAGG - Intronic
1101332089 12:103765416-103765438 GTCACTAAAAATAGTGTCAAAGG - Intronic
1101362552 12:104041651-104041673 ATGAATCAAAGAAATGTCAAGGG - Intronic
1102856185 12:116296141-116296163 TTGAATTAAAAAAATGTGAATGG - Intergenic
1102924842 12:116818949-116818971 GAGAAGAAAAAGGCTGTCAAAGG + Intronic
1103359221 12:120343764-120343786 GTGAATGAACAGAATGTCATGGG + Intronic
1103646935 12:122401375-122401397 ATTAATAAAAAGTAGGTCAATGG + Intronic
1104143883 12:126013781-126013803 AAGAATAAGAAGAATGTAAAAGG + Intergenic
1105743312 13:23351606-23351628 GTAAATAAAAAGAAGTTTAATGG - Intronic
1106486290 13:30175472-30175494 TTGAACAAAATGAATTTCAATGG + Intergenic
1106548740 13:30753136-30753158 GTGAATGAAGACAATGACAAGGG + Intronic
1108467257 13:50728762-50728784 GTAAAGAAAAAAAAAGTCAATGG - Intronic
1108610055 13:52076557-52076579 GTGGATGACAAGAATTTCAAAGG + Intronic
1109004557 13:56855340-56855362 CAGAAAAAAAAGAATGTGAAAGG + Intergenic
1109061260 13:57623099-57623121 GAGAATAAAAAGATTGTCCAGGG - Intergenic
1109378284 13:61525364-61525386 GGGAATAAAAAGTATTTTAAGGG + Intergenic
1109875783 13:68402970-68402992 GCTAACAAAAAGAAAGTCAAGGG - Intergenic
1110149478 13:72232631-72232653 TTGTATTAAAATAATGTCAAGGG + Intergenic
1110480729 13:75972926-75972948 GTAAAGAAGAAGAAGGTCAATGG - Intergenic
1111003811 13:82222153-82222175 CTGAATAAAAAGCATGTCCTTGG - Intergenic
1112145966 13:96700536-96700558 TCAAATAAAAAGAATGTAAAAGG - Intronic
1112221572 13:97496585-97496607 GAGAGTAAACAGAATATCAAAGG - Intergenic
1112863249 13:103861597-103861619 GTGAAGCAGAAGAATGTCAATGG + Intergenic
1113142133 13:107165719-107165741 ATGAATAAAAAGACTTTCAGTGG - Exonic
1114737935 14:25062286-25062308 GTGAAAATTAAGAATGTCACTGG - Intergenic
1115101758 14:29709733-29709755 TAGAATAAAAAGAATGACTAGGG - Intronic
1115301056 14:31885772-31885794 AGTAATAAAAAGAATGTCAGCGG - Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1116645856 14:47528064-47528086 GTGGATACAAAAAAGGTCAAGGG - Intronic
1116672900 14:47866234-47866256 CTCAATAAAAAAAATGTCAGTGG + Intergenic
1116765332 14:49063483-49063505 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
1118103442 14:62630990-62631012 GTGAAAATAAAGAATGCCATGGG + Intergenic
1118153136 14:63211220-63211242 GTGAATAAAAATAAAGTCCCAGG + Intronic
1120303438 14:82737268-82737290 GTGAAAAAAAAAAATGTTAAAGG - Intergenic
1121167945 14:91825432-91825454 GGGGATAAAAAGAATTTGAAAGG - Intronic
1121916950 14:97844216-97844238 GTGGATCAAAACAGTGTCAATGG + Intergenic
1122815660 14:104310891-104310913 TTGATCAAAAAGAATCTCAAAGG + Intergenic
1124662837 15:31564105-31564127 GGGATTAAAAAAAATGTTAATGG + Intronic
1124841375 15:33245016-33245038 GTGGGGAAAAAGAAAGTCAAGGG + Intergenic
1125170229 15:36758561-36758583 GTGAAGAAAAAGACTGTCGCAGG - Intronic
1125174054 15:36799629-36799651 TTGAATAAACAAAATGCCAAAGG - Intronic
1125350536 15:38762437-38762459 GTGAATACAAAAAAGGTTAAAGG - Intergenic
1126084918 15:45002372-45002394 GTTAATAGAAAGTATGTTAATGG + Intergenic
1126938430 15:53738290-53738312 GTAAATACAAAGAATGCAAAAGG + Intronic
1126983636 15:54276149-54276171 CTGATTACAAAGAATCTCAAAGG + Intronic
1127283392 15:57511246-57511268 GTGTATAAAAAGAAGGTAAGAGG - Intronic
1127317047 15:57806939-57806961 TTGAATAATAAAAATGGCAATGG - Intergenic
1128002414 15:64205835-64205857 GTGAAGAAATAAAATCTCAAAGG + Intronic
1128529914 15:68437720-68437742 TTGAAGAAAAAGTATGTCAAAGG + Intergenic
1128578805 15:68794393-68794415 GTGAAGGAAAAGAAAATCAAGGG - Intronic
1130636256 15:85623420-85623442 GTGAATTATTAGGATGTCAATGG - Intronic
1131690212 15:94819043-94819065 GTGAATAAAAATAATGAGAAAGG - Intergenic
1131798665 15:96046902-96046924 GTGAATAAAAAGAATTGCATAGG + Intergenic
1132140632 15:99390665-99390687 GTGAATGCTCAGAATGTCAATGG + Exonic
1133564020 16:6975797-6975819 GTGAATAAAGATAATGGTAATGG + Intronic
1134378128 16:13698567-13698589 GTGCATAAAAAGAATAAAAATGG + Intergenic
1137799874 16:51253327-51253349 ATGAATGAAAAAAATGTTAAGGG - Intergenic
1137879969 16:52035725-52035747 GAAAAAAAAAAGAATGCCAAAGG - Intronic
1138849683 16:60612189-60612211 GTGACAAAAAAGAATATGAATGG + Intergenic
1138992176 16:62404862-62404884 TTGAATGAATACAATGTCAAAGG - Intergenic
1139475023 16:67198893-67198915 GTGAATAAAAACCATGCCTAAGG + Exonic
1139928986 16:70510103-70510125 GTGAAAAAAAAGAAAGTCAATGG - Intronic
1141210968 16:81979259-81979281 ATGAAGGAAAAAAATGTCAAGGG + Intergenic
1145401112 17:22533855-22533877 GTGAATAAAAACACAGTAAAGGG + Intergenic
1146468422 17:33105440-33105462 ATAAATAAAAAGAAGGTTAATGG - Intronic
1147545464 17:41397907-41397929 GTGACACAAAAGAATGTCATCGG - Intergenic
1147795628 17:43040387-43040409 GTGAATAACAATAAGGTTAATGG - Intergenic
1148005293 17:44422966-44422988 ATGTATTAAAAGAATGTCCACGG + Intronic
1148193263 17:45695013-45695035 GTGAAAAAGAAGAATGGCAAGGG + Intergenic
1149046117 17:52247383-52247405 GAGAAAAAAGAGAATGTTAAAGG + Intergenic
1149064275 17:52461536-52461558 ATGAATTAACAGATTGTCAAGGG - Intergenic
1149676648 17:58470588-58470610 GTGAATATAAGTAGTGTCAATGG + Intronic
1149920321 17:60652109-60652131 GTGGAAAAAAAGAATATAAATGG - Intronic
1150335636 17:64328610-64328632 TTCCATAAAAAGAATGTCAGTGG + Intronic
1151024659 17:70663708-70663730 CTAAATAAAAAGAATGGCATGGG - Intergenic
1151173864 17:72270859-72270881 TTTAAAAAAAAAAATGTCAAGGG - Intergenic
1152115420 17:78383768-78383790 GTGAATTAAAAGATTTACAACGG + Intronic
1152511359 17:80791422-80791444 GAGAAAGAAAAGAATGTGAACGG - Intronic
1152948818 17:83214170-83214192 AAGAATAAAATGAATGTCCATGG + Intergenic
1153420606 18:4900748-4900770 TGGAACAGAAAGAATGTCAATGG - Intergenic
1153422725 18:4926380-4926402 GAGAATACATAGAATGTGAATGG + Intergenic
1154102104 18:11485570-11485592 AAGAAGAAAAAGAAAGTCAAGGG + Intergenic
1154312162 18:13275766-13275788 AAGAATAAAAAAAATGTTAAAGG + Intronic
1154396788 18:13998107-13998129 GTGAAAAAAAATAATGTCTCTGG - Intergenic
1155821612 18:30385033-30385055 GTGAATAAAAGTTATGTGAATGG - Intergenic
1156156297 18:34306695-34306717 GTTAATAACAAGAATGTTTAAGG + Intergenic
1156512451 18:37650759-37650781 ATGAACACAAAGAATGTAAAAGG + Intergenic
1156661997 18:39357267-39357289 GAGCATAAACAGAATGGCAAAGG - Intergenic
1156875094 18:42000635-42000657 GAGAAGAAAAAGAATTTTAATGG + Intronic
1157004631 18:43567343-43567365 GTGAATTAAAACAATTTAAAAGG - Intergenic
1158446636 18:57527846-57527868 GAGAATAAAATGAAGGTCACAGG - Intergenic
1158503962 18:58029534-58029556 GTTAATGAAAAAAATGTCAGTGG + Intergenic
1160108110 18:75998361-75998383 GTGAATCAAAGAAATCTCAAAGG - Intergenic
1160993311 19:1870280-1870302 CTGAATAATAATAATGACAATGG + Intergenic
1163078050 19:14913681-14913703 GGAAATAAAAAGAATGTTAGGGG - Intergenic
1164993488 19:32701786-32701808 ATGAATCAAAAGAAAGTCAGAGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
925945247 2:8856502-8856524 GAGAATAGAAAGAATGTTCATGG - Exonic
926536617 2:14121135-14121157 CTGAAAAAAAAGAAAGACAAAGG - Intergenic
926559170 2:14396235-14396257 GAAAATAAAAAGAATGACAAAGG - Intergenic
926777166 2:16434105-16434127 GTGAAATAAGAGAAAGTCAAAGG - Intergenic
928057355 2:28071157-28071179 ATGAAGACAAAGAATGTCGAGGG - Intronic
929630612 2:43457785-43457807 GTGAATAAAAAGAATGAAATTGG - Intronic
929842476 2:45483499-45483521 AAGAATAAAAAGAATGTCATGGG + Intronic
930639072 2:53836688-53836710 GATAATAAAAAGAATGAAAAAGG + Intergenic
932067054 2:68575340-68575362 GTGAGTAAACAGAATGGCATAGG + Intronic
932209091 2:69913067-69913089 CTGAAGAAAAAGAAAGACAAAGG - Intronic
932251789 2:70251036-70251058 GTGAATAAAACAAATGTTAATGG + Intergenic
932355734 2:71067404-71067426 GTGAATTAAAAAAATGCCATAGG + Intronic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933042060 2:77481574-77481596 GAAAAAAAAAAGCATGTCAAGGG + Intronic
933060220 2:77727340-77727362 GTGAATAATCAGAATGTTGAGGG - Intergenic
933411562 2:81931484-81931506 ATGTATAAAAATAATGTAAATGG - Intergenic
933512064 2:83253186-83253208 GGGAAAAAAAAGAATCTCAGGGG + Intergenic
935034985 2:99361701-99361723 GTAAACAAAAGGAATCTCAAAGG + Exonic
935319498 2:101872042-101872064 TTGGATAAAAAGAATGAAAAAGG - Intronic
935410089 2:102752322-102752344 CTAAATAACAAAAATGTCAAAGG - Intronic
936382233 2:111996395-111996417 GGGCACAAAAAGAATGACAAGGG - Intronic
936768459 2:115882849-115882871 AAGAATAAAATGAATGGCAAAGG - Intergenic
937558062 2:123184370-123184392 GTGAATATTAAAAATGTGAAAGG + Intergenic
937567970 2:123319232-123319254 GTGAATAAACAGATTGGAAATGG + Intergenic
939055046 2:137354952-137354974 TTAAATAAAAAGAATAGCAAGGG + Intronic
939207810 2:139130095-139130117 CTGAAAAAAAAGAGTCTCAAAGG + Intergenic
939465798 2:142554646-142554668 AGGAATAAAAAGAAAGTAAAAGG - Intergenic
940504513 2:154535811-154535833 TTGAATAAAAAGAATGAAAAAGG + Intergenic
940596473 2:155799776-155799798 GTCCATAAAAAGAATGTTCAAGG + Intergenic
940657247 2:156502854-156502876 TGGAATAAAAAAAATGTAAATGG - Intronic
941601964 2:167553872-167553894 GTGATTAAAAAGAAGGTAAAAGG + Intergenic
941700421 2:168598470-168598492 GTAAAAAAAAATAATGGCAAGGG + Intronic
941996621 2:171607305-171607327 ATGAATAAAAATCATGTCCAGGG + Intergenic
942012911 2:171781626-171781648 ATGAATAACAAGGATGTGAAAGG + Intergenic
942839645 2:180344414-180344436 GTTATTAAATAGAATTTCAAAGG + Intergenic
942864416 2:180655834-180655856 CTGAATAAAATGAATGTCAAGGG - Intergenic
942999437 2:182306748-182306770 ATGAAGAAAAAGAATGACATTGG + Intronic
943199591 2:184803370-184803392 GTGAATATAAAGGAAGGCAAGGG - Intronic
943314137 2:186364775-186364797 GTGAGTCAGAAGTATGTCAATGG + Intergenic
944201232 2:197109327-197109349 TTCAATAAAATGAATGTCAAAGG + Intronic
944309250 2:198214890-198214912 GAGAATAAAAAGAATTTGACAGG + Intronic
944641949 2:201736569-201736591 GTGAACAAAAAGAAAGTAGAAGG + Intronic
945224866 2:207523326-207523348 GAGAATAGAATGAATGTTAAGGG + Intergenic
945516359 2:210767600-210767622 GTTAATAAAAATAATCTCTAGGG + Intergenic
945608282 2:211964485-211964507 GTTAATAAAAATAATGACATAGG + Intronic
946309411 2:218874382-218874404 GTGAACAAGAAGAATGCCAAGGG - Intergenic
947251063 2:228104821-228104843 ATGAATAGAAATAATGTGAATGG + Intronic
948734525 2:239992880-239992902 ATGGATAAAATGAATGTCACTGG + Intronic
1170369175 20:15629989-15630011 GGGAAGAAAAAGAATGAGAACGG - Intronic
1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG + Intronic
1170519839 20:17173285-17173307 ATTAATAAAAAGAGTGTCAGAGG + Intergenic
1171014679 20:21529425-21529447 GTGAAAAAAAAAGATGTGAAAGG - Intergenic
1173866575 20:46316388-46316410 CAGAATAAATAGAATGTCAGAGG + Intergenic
1174838095 20:53876943-53876965 GTGTATAAAAACAATTTGAATGG + Intergenic
1175536200 20:59715796-59715818 GTTAAGAAAAAAAATGTTAAAGG + Intronic
1176881316 21:14197838-14197860 ATGAAAAAAAAAAATGTTAAAGG + Intronic
1176976920 21:15333163-15333185 GAAAAAAAAAAGAATGTTAAAGG - Intergenic
1176985740 21:15433495-15433517 GCGAATATACAGAATGTTAAGGG - Intergenic
1177348873 21:19909327-19909349 GTATTTTAAAAGAATGTCAAAGG - Intergenic
1177823054 21:26052819-26052841 GTGCATAAAAATAATCTGAAGGG + Intronic
1179338593 21:40482170-40482192 GTGAATAAAAAGACTGGAAATGG - Intronic
1180240397 21:46499662-46499684 GTTAAAAAATAGAATTTCAAAGG - Intronic
1182840812 22:33388442-33388464 ATGAATAAAAGAAATGTAAAAGG - Intronic
1183848951 22:40566874-40566896 GTGTAGAGAAAGAATGACAAGGG + Intronic
949743376 3:7262092-7262114 ATGAAAAAAAAAAAAGTCAAAGG - Intronic
949958550 3:9291037-9291059 GTGATTAAAAAGAATATAAAGGG - Intronic
950817447 3:15721006-15721028 GTGAATCAAAAGAATGAAAAAGG - Exonic
950891420 3:16408123-16408145 GGGAATCAAAAGAACGTCAGAGG - Intronic
951940511 3:28072959-28072981 GTGATTATTAAGAATGTAAAAGG - Intergenic
952174454 3:30846650-30846672 ATGAACAAAAAGAGTGTCCAAGG + Intronic
952208190 3:31201505-31201527 GAGAATAAAATTGATGTCAAAGG + Intergenic
953081133 3:39619414-39619436 ATGAAGGAAAAAAATGTCAAAGG - Intergenic
953518224 3:43617725-43617747 GTAAAGAAAAAAAAAGTCAATGG + Intronic
953593793 3:44287912-44287934 GTGAATAAAAGGCAGCTCAAGGG - Intronic
955056094 3:55457369-55457391 GGGAATAAAATGAATGCAAATGG - Intergenic
956562085 3:70590359-70590381 GTGAACAAGAAAAAAGTCAATGG - Intergenic
957283801 3:78189118-78189140 GAGAAAAAAAAAACTGTCAAAGG + Intergenic
957433962 3:80150736-80150758 GTGAAGGAAAAAAATGTTAAGGG - Intergenic
957499390 3:81034347-81034369 TTGACAAAAAAGAATGTGAAAGG - Intergenic
957621012 3:82593758-82593780 GTGAATAAAAATAAATTCCATGG + Intergenic
957898575 3:86456098-86456120 GTGAAAAAACACAATCTCAAAGG + Intergenic
958116256 3:89221912-89221934 GAGAAAAAAAAGATTGGCAATGG + Intronic
959586622 3:108031318-108031340 GAGAATAAAAAGGATATCCAAGG - Intergenic
960268516 3:115648872-115648894 GTGATTAAGAAGGATGACAATGG + Intronic
960551659 3:118982541-118982563 GACAATAAAAAGAAGGACAAAGG + Intronic
960712640 3:120546254-120546276 GTGAGTAAATAGATTGTCATGGG - Intergenic
960951730 3:123003336-123003358 TTGAACTAAAAGCATGTCAATGG - Intronic
961702768 3:128759575-128759597 GTTAAAGAACAGAATGTCAAAGG - Intronic
962988831 3:140560294-140560316 CAGCATAAAGAGAATGTCAATGG - Intronic
964090272 3:152867825-152867847 GTAAATATATAGAATGGCAAGGG - Intergenic
964278713 3:155037876-155037898 GTGAATAAAAAGAGAGGAAATGG + Intronic
964563937 3:158029123-158029145 GTTAATAAAAATCATGTAAATGG + Intergenic
964741623 3:159972007-159972029 TTAAAAAAAAAGAATGTAAAGGG + Intergenic
965311658 3:167135518-167135540 ATAAAAAAAAATAATGTCAAAGG + Intergenic
965641799 3:170836640-170836662 GTGAAGAACAAGGATGTGAAAGG - Intronic
965983432 3:174722102-174722124 GTAAATAAGAAGAATGGGAAAGG - Intronic
966299799 3:178465292-178465314 GTCACTAAAAACAAAGTCAAAGG + Intronic
966570113 3:181431852-181431874 GTGATTTAAAAGTATGTCAGTGG - Intergenic
966790347 3:183662865-183662887 GTTTATAACAAGAATGTTAAAGG - Intronic
967068454 3:185941294-185941316 GTGAGTAATATGAATGTCAAGGG - Intergenic
967267933 3:187707463-187707485 TTAAATAAAAAAAATGTTAAAGG + Intronic
967429000 3:189360325-189360347 ATGACTAAAAATAATGTCAAGGG + Intergenic
967512635 3:190329722-190329744 GGGAATAAAAAGACATTCAATGG + Intronic
967552906 3:190820125-190820147 GTGCACATAAAGAATGTCAAAGG + Intergenic
967602179 3:191403064-191403086 GTGAATAAAATAAATATCACTGG - Intergenic
968352229 3:198067736-198067758 GTAAATAAAATAAATGACAATGG + Intergenic
968709895 4:2106543-2106565 TTGAATAAGAAGAGTGTCACTGG + Intronic
970645511 4:18115913-18115935 GTGAATTACAAGACTGTAAAGGG - Intergenic
971417224 4:26442866-26442888 GTGAAGAAAAAGCAGGTCAAGGG - Intergenic
972003767 4:34072430-34072452 GTCAACAAAAAGCATGTAAATGG + Intergenic
972032608 4:34480051-34480073 TTAAATAAAAAGAATGTCATAGG - Intergenic
972306216 4:37832509-37832531 GTGATTCAAAAATATGTCAAAGG + Intronic
972635460 4:40880026-40880048 GTTAATAAAAAGAGTGTCACTGG + Intronic
973129806 4:46636405-46636427 ATGAATAAATAAAATGTTAAAGG + Intergenic
973588058 4:52412172-52412194 GGGAAGAAAAAGAAGTTCAATGG + Intergenic
974711328 4:65599965-65599987 GTCAATCAAAATAATGACAAAGG + Intronic
974944003 4:68504660-68504682 GTGAAGGAAAAAAATGTTAAGGG + Intergenic
975510054 4:75184415-75184437 GCCAATAAAAAAAATGTCCAGGG + Intergenic
976077943 4:81320770-81320792 GTGAAAAAAAAAAAAATCAATGG + Intergenic
976549908 4:86381952-86381974 GGGAGGAAAAACAATGTCAAGGG - Intronic
976651896 4:87444536-87444558 GTTAATAAAAAAAATATTAATGG + Intronic
977070412 4:92377634-92377656 GTGAAGAAAAAGAAGTTTAATGG + Intronic
977135184 4:93295141-93295163 GTGAATAAAATGAAAGTTTAGGG + Intronic
977675886 4:99746289-99746311 GTAAGAAAAAAGAATATCAAAGG + Intergenic
978141226 4:105319341-105319363 GTGAAGAAAAAGAAGGGAAAGGG + Intergenic
979426210 4:120571148-120571170 GTGAATAAAAAGACAATTAAGGG + Intergenic
980059787 4:128116878-128116900 CTTGATAAAAAGAATGTGAATGG - Intronic
980283264 4:130750347-130750369 CTGAATAAAATGAATGAAAATGG + Intergenic
980500299 4:133642490-133642512 GCGAATGCAAAGAATGTAAATGG - Intergenic
982392532 4:154881174-154881196 GAGAAAAAAAAGAATGTTAATGG + Intergenic
983012752 4:162568345-162568367 ATGAGTAAAAGCAATGTCAATGG + Intergenic
983680869 4:170352022-170352044 CTGAATAAAAAGAACTTCAGTGG - Intergenic
984442426 4:179789231-179789253 GTGAATAAAAAGTCTGACATGGG - Intergenic
984521445 4:180806649-180806671 GAGAATAAAGATAATGACAAGGG - Intergenic
985482322 5:121833-121855 GTGAATAAAAGAAATGCCAAAGG + Intergenic
986926647 5:12762072-12762094 CTGAATATAAAGGAAGTCAATGG - Intergenic
987944145 5:24582698-24582720 GTCAATAGAAAGATTGACAAAGG + Intronic
988791258 5:34610013-34610035 TGGAATGAAAAGAATGTGAAGGG - Intergenic
989423802 5:41272266-41272288 GTGAGTAAATAAAATTTCAATGG + Intergenic
990658982 5:57991402-57991424 GTGTATATAAGGCATGTCAAGGG + Intergenic
991035752 5:62125771-62125793 GTCAAAAAAAAAAAAGTCAAGGG - Intergenic
991528783 5:67592819-67592841 GTGAAGAAAAAGAATGTTCTTGG - Intergenic
992786978 5:80179362-80179384 GTGATGAAAAAGAATGTGATGGG - Intronic
993784934 5:92118672-92118694 GTAAATAAATAAAATGTAAATGG - Intergenic
994138199 5:96312412-96312434 GTCAATAAAATGTTTGTCAAAGG - Intergenic
995372340 5:111433002-111433024 ATGGATAAAAAGAATGTCATGGG + Intronic
995758764 5:115542949-115542971 GTTAATAGAAAAAGTGTCAAAGG - Exonic
996249021 5:121303819-121303841 GTGAATAAAAAGCAAGCCCAGGG + Intergenic
996568115 5:124903426-124903448 GAGATTAAAGAGCATGTCAAAGG + Intergenic
996592448 5:125162410-125162432 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
996691602 5:126346270-126346292 GAGAAGAAAAAGAATGACTAAGG - Intergenic
996870670 5:128189437-128189459 GCATATAAAAAGAATGTAAAAGG - Exonic
998753089 5:145346117-145346139 ATGAATAAACAGAATTTCAAAGG - Intergenic
999061609 5:148641629-148641651 GTGAAGAAAAAGAAGCTCAAGGG - Intronic
1000173002 5:158722272-158722294 GTGACTTAAAAGATTTTCAAGGG - Intronic
1000545459 5:162594909-162594931 GTGAATCAGCAGAATGTAAATGG + Intergenic
1000579050 5:163012647-163012669 GCGAATAAACAGAATGTAAGTGG + Intergenic
1001186124 5:169574595-169574617 GTGTAAAAAAAAAATGTGAAGGG + Intergenic
1001866638 5:175111785-175111807 GGGAATGAAAAGAAGGCCAAGGG + Intergenic
1002743025 5:181447633-181447655 AAGAATAAAATGAATGTCCATGG + Intergenic
1004672709 6:17813018-17813040 GTAAATAGAAAGGATATCAATGG + Intronic
1004769238 6:18763188-18763210 GTGAGGAAAAAGTATGTTAAGGG - Intergenic
1007050521 6:38823938-38823960 GTGTGTATAAAGAATATCAATGG - Intronic
1007758890 6:44120314-44120336 GGGAAGAAATAGAATGTTAAAGG - Intronic
1008407424 6:51134858-51134880 ATGAATGAAAAAAATGTTAAGGG - Intergenic
1009508912 6:64522785-64522807 GTAAATAAAACAGATGTCAAAGG + Intronic
1009689582 6:67011002-67011024 GGGAATAGAAAGAAAATCAAAGG - Intergenic
1009809491 6:68642132-68642154 GTGAATAAAATGGGAGTCAAAGG - Intronic
1010623583 6:78107246-78107268 GTGAATGATAAGAATGAAAAAGG - Intergenic
1010907973 6:81516450-81516472 AAGAATATAAAGAATGTGAAAGG + Intronic
1011471853 6:87716136-87716158 GTAAATAAAAAGAATGTGGCTGG + Intergenic
1012421440 6:99070155-99070177 GTGAAGAAAAGGAATGGAAAAGG - Intergenic
1012422699 6:99081830-99081852 GTGACTAAGAAGAATTTCCATGG + Intergenic
1012444846 6:99297006-99297028 ATGAATAACAAGAATGTTAAGGG + Intronic
1013939773 6:115646880-115646902 ATGAAGAAAAAAAATGTTAAGGG + Intergenic
1014214560 6:118740094-118740116 GAGAAAAAAATGAATGTTAATGG - Intergenic
1014333178 6:120096531-120096553 TTGAGTACAAAGAATCTCAAAGG + Intergenic
1015566873 6:134582039-134582061 GAAAATAAAAACAATGGCAAAGG + Intergenic
1015704367 6:136072071-136072093 CTGAATGAAAAAAATGTTAAAGG - Intronic
1015839995 6:137466786-137466808 GGGAATGAAAAGAAATTCAATGG + Intergenic
1016164297 6:140921005-140921027 CTGAATAACAAGAATATAAAGGG - Intergenic
1016723876 6:147336535-147336557 GTGAATCAAAAGAACCACAAGGG + Intronic
1016787056 6:148022449-148022471 ATAAATAAATAAAATGTCAAGGG - Intergenic
1018323451 6:162637558-162637580 GTGGATAGAAGGAATGTCCATGG - Intronic
1019248125 6:170723056-170723078 AAGAATAAAATGAATGTCCATGG + Intergenic
1019986212 7:4657934-4657956 GTGAATACAAGGAACTTCAATGG - Intergenic
1020743089 7:12046888-12046910 GTGAATACACAGAATATTAAGGG - Intergenic
1020960168 7:14792777-14792799 TTGAATAGAAAAAATGTCAGGGG - Intronic
1021070966 7:16239898-16239920 GTGAATAAAATGAATTCCAGAGG - Intronic
1021328484 7:19304219-19304241 GTGAATAAAAAATATCTGAAAGG + Intergenic
1021515127 7:21475907-21475929 GGGAATAACAAGTATGTGAATGG - Intronic
1022382332 7:29872139-29872161 GTCACTAAAAAGACAGTCAAGGG - Intronic
1023115819 7:36861427-36861449 GTAAAGAAAAAGGATGTAAAAGG - Intronic
1023635876 7:42209605-42209627 TTGAATATCAAGAATATCAAGGG + Intronic
1023726211 7:43144905-43144927 GTGAGAAAATAGAATGTAAAAGG - Intronic
1024526287 7:50352562-50352584 CTGAGTAAGAATAATGTCAATGG + Intronic
1027361910 7:77417489-77417511 GTGAATAAAAGGAAGGCCACTGG + Intergenic
1027837049 7:83257545-83257567 GTGAATTCAAAGAAAGTAAAGGG + Intergenic
1028125994 7:87114173-87114195 GTGAAGAAAAAGAAGTTTAATGG - Intergenic
1028312979 7:89361923-89361945 GTGAAAAAAAAGGAGGTGAATGG - Intergenic
1028486227 7:91360361-91360383 ATGAATTAAAAGAATGTATATGG + Intergenic
1029899575 7:104024548-104024570 GGGAATAAAAAGAATCAGAAAGG + Intergenic
1029911989 7:104162681-104162703 GTGAATATAATGAATACCAATGG + Intronic
1031071952 7:117171536-117171558 GTGAGTAACCAGAATGGCAAAGG - Intronic
1031099379 7:117460637-117460659 CTAAATAAAAAGAAAGACAAAGG - Intergenic
1031204850 7:118743749-118743771 GTGAATTAAAGGGATGTCAAAGG + Intergenic
1031238132 7:119202907-119202929 CTGAATAAAGAGAACATCAAAGG + Intergenic
1031352998 7:120758419-120758441 GTGAATTAAAATAAAGTAAATGG - Intergenic
1031822404 7:126520514-126520536 GTGAATGATGAGAATGTCAAGGG + Intronic
1032305096 7:130725675-130725697 GTGGATAAAAATAATGTCTGTGG - Intergenic
1032552606 7:132799059-132799081 GTGTACAAAAAGAATTTCAGAGG - Intronic
1034031909 7:147776326-147776348 ATGACTAAAATGAATGTAAAAGG + Intronic
1034686734 7:152978379-152978401 CTGAAAAAAAAAAATCTCAAAGG + Intergenic
1034736868 7:153437442-153437464 ATGAATAAAAGGAAAGTCACAGG - Intergenic
1035108513 7:156461664-156461686 GAGAATAAAAACAATGGAAAGGG + Intergenic
1035499975 8:84677-84699 AAGAATAAAATGAATGTCCATGG - Intergenic
1035610605 8:960979-961001 TTGATGAAAAAGAATATCAATGG - Intergenic
1035943040 8:3925764-3925786 GGGAATAAAAAGAGGTTCAATGG - Intronic
1037510778 8:19579675-19579697 CTGAATAAACAGAAAGTTAAAGG + Intronic
1038385084 8:27136402-27136424 GTGAAAAAAATGAAGGTCAAGGG + Intergenic
1038467733 8:27781082-27781104 GTGAATAAAAATAATACAAATGG + Intronic
1039644952 8:39271174-39271196 GTAAAGAAAAAGAATGTATAGGG + Intronic
1039645188 8:39274612-39274634 GTAAAGAAAAAGAATGTATAGGG + Intronic
1040836787 8:51740627-51740649 GTGAATAGAAAAATTCTCAAAGG - Intronic
1041808675 8:61884075-61884097 GTAAAGAAAAAGAATTTTAAGGG + Intergenic
1042489704 8:69382878-69382900 ATGAAAGAAAAAAATGTCAAAGG + Intergenic
1044214263 8:89589182-89589204 TTTAATAGAAAGAATGACAATGG - Intergenic
1044616790 8:94150726-94150748 GTGAATAAAAAGTTTATCAGTGG - Intronic
1045851887 8:106710387-106710409 ATGAATAAAAATTATGTCTAAGG - Intronic
1046071859 8:109265328-109265350 GGAAAAAAAAAGAATGTAAAGGG + Intronic
1046961198 8:120115047-120115069 GTTGATTAAAAGAATGTGAATGG + Intronic
1047052453 8:121128245-121128267 GCCAATGAAAAGAATTTCAAGGG + Intergenic
1047092803 8:121592211-121592233 GTGGAGATAAAGAATGACAATGG + Intergenic
1049031059 8:140038167-140038189 GAGAATAAAAAGGATGGCACAGG + Intronic
1049980762 9:901817-901839 GTGGATAACAAGACTGTGAAGGG - Intronic
1050062536 9:1725079-1725101 GTGAAATAAATGAATGTCACAGG - Intergenic
1050294434 9:4190750-4190772 ATGAATGAAAAAAATGTTAAGGG + Intronic
1050682071 9:8123330-8123352 GAGAATAAAAAGGATGTTAAGGG + Intergenic
1051417022 9:16852799-16852821 GTGAAAAAAAAGAACCTCACAGG + Intronic
1052725557 9:32224518-32224540 GGCAAAGAAAAGAATGTCAAAGG - Intergenic
1053230304 9:36401987-36402009 GTTCATAAAGAGAATGTCCAAGG - Intronic
1055585446 9:77754553-77754575 GTGTATTAACAGAATATCAATGG + Intronic
1055776917 9:79776334-79776356 GGGAATAAAAAGGAAGACAAAGG - Intergenic
1055782404 9:79833523-79833545 GTGAAAGAAAAGAAAGACAAGGG - Intergenic
1056261335 9:84851635-84851657 GTCACTAAAAAGAAAGACAAAGG + Intronic
1056761266 9:89416920-89416942 GTAAATAAAAAAAAGGTCAAAGG - Intronic
1057590531 9:96369431-96369453 CTGAATGAAAAGAAAGGCAAAGG + Intronic
1059639844 9:116205740-116205762 GTTAATAAAGAGAGTGTAAAGGG - Intronic
1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG + Intronic
1059936338 9:119314945-119314967 GTGAACAAAAACACTGTCATAGG - Intronic
1060171788 9:121467909-121467931 GAGAAAATAATGAATGTCAAAGG - Intergenic
1060610060 9:124955683-124955705 GTGAAAAAAACGAAAGTTAATGG + Intronic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1203608907 Un_KI270748v1:78668-78690 AAGAATAAAATGAATGTCCATGG + Intergenic
1185669886 X:1799493-1799515 GTGTATAAATATAATCTCAAGGG + Intergenic
1185926834 X:4156394-4156416 AAGAATATAAACAATGTCAATGG + Intergenic
1185952656 X:4453346-4453368 ATGAAGGAAAAAAATGTCAAGGG + Intergenic
1186307322 X:8276395-8276417 TTGAAAAAAAAAAATGTGAAAGG + Intergenic
1186365577 X:8889610-8889632 GTGAATAAAAAGCTTGTGAAAGG + Intergenic
1186499558 X:10040471-10040493 GTGAGTAAAAAGTATGATAAAGG + Intronic
1187659073 X:21518186-21518208 GTGAAAAAAAATAATGTAATGGG - Intronic
1187683838 X:21796475-21796497 GTGAAAACAAAAAATATCAAAGG + Intergenic
1188169371 X:26904374-26904396 ATGAATATAAAGAATCTCAAAGG + Intergenic
1188171214 X:26929562-26929584 CAAAATAAAAATAATGTCAATGG - Intergenic
1188645520 X:32561894-32561916 GTGAAAGAAAAGAATTTCCAAGG + Intronic
1188734748 X:33698841-33698863 GGGCATAAAAAGAATGCAAAAGG + Intergenic
1188869543 X:35357642-35357664 TTGAAAATAAAGAATGTTAAAGG - Intergenic
1189557139 X:42156733-42156755 GTTTAAAAAAAGAATGTCGATGG - Intergenic
1189894732 X:45643272-45643294 CTGAATGAAAGGAATTTCAAGGG - Intergenic
1190361410 X:49652788-49652810 GTGAATTAAATGAATGGAAATGG - Intergenic
1191133700 X:57041629-57041651 TTGAATAGAAAGAATATCAAGGG - Intergenic
1191885129 X:65880429-65880451 GTGATTTAAAAGATTTTCAAGGG + Intergenic
1192997886 X:76531829-76531851 ATGAAGAAAAAAAATGTTAAGGG - Intergenic
1193548123 X:82853979-82854001 GGGAATGAAAAGTAGGTCAAAGG + Intergenic
1193778411 X:85672607-85672629 GTTAATAACAAGAATGTATAAGG - Intergenic
1193845003 X:86457682-86457704 ATGAAGAAAAATAAAGTCAAGGG + Intronic
1195442748 X:104917280-104917302 GTGAAAGAAAAGAATCTGAAAGG + Intronic
1195470682 X:105226363-105226385 GGGAAAAGAAAGAATGGCAAAGG - Intronic
1195732982 X:107984110-107984132 GTGAATGAAAAGAATGGGAGTGG - Intergenic
1196229150 X:113201565-113201587 TTGAAAAAAAAAAATGTTAAGGG - Intergenic
1196584255 X:117410844-117410866 ATGAAGAAAAAAAATGTTAATGG + Intergenic
1197688235 X:129467420-129467442 TTGAATGAAAAGAATGTAAAAGG - Intronic
1198182001 X:134219452-134219474 GAGAATAAAAAAAATGGCAAAGG + Intergenic
1198531844 X:137555712-137555734 GTGAATAAAAAGTTTTTCCACGG + Intergenic
1198615564 X:138454820-138454842 GTGAATAACAGCAATGTCACAGG + Intergenic
1199098485 X:143769354-143769376 ATGAAATAAAAGAATGTTAAAGG + Intergenic
1199637905 X:149830577-149830599 ATGAAAAAAAAGAAAGTAAAGGG + Intergenic
1199823027 X:151469976-151469998 GAGAATAACAAGAATGTTATAGG - Intergenic
1199844983 X:151686186-151686208 GTGAATCAGAAAAATGTCAGAGG + Intergenic
1199901972 X:152183983-152184005 CAGAAAAAAAAGAATGTGAAAGG - Intronic
1200817645 Y:7550084-7550106 GTGACTAAAATGACTGCCAAGGG - Intergenic
1202593333 Y:26510522-26510544 GTGAATAATAAAAATGTAACTGG + Intergenic