ID: 1101201043

View in Genome Browser
Species Human (GRCh38)
Location 12:102436602-102436624
Sequence TTGTGGCAAAGGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101201035_1101201043 25 Left 1101201035 12:102436554-102436576 CCTTCAGTACCACATCATCAAAA 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG 0: 1
1: 1
2: 0
3: 26
4: 398
1101201036_1101201043 16 Left 1101201036 12:102436563-102436585 CCACATCATCAAAATATCTTTTC 0: 1
1: 0
2: 2
3: 49
4: 424
Right 1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG 0: 1
1: 1
2: 0
3: 26
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101201043 Original CRISPR TTGTGGCAAAGGAGGGTGGA AGG Intronic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
901216443 1:7558091-7558113 TTGGGTCACAGGAGGGTGGCTGG - Intronic
901663734 1:10814922-10814944 TTGCCCCCAAGGAGGGTGGAGGG + Intergenic
901767974 1:11515794-11515816 TTGGGGCCAAGGAGTGTGGTGGG + Intronic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
903213937 1:21832954-21832976 TGGAGGCAGAGGAGGGAGGAAGG + Intronic
903506738 1:23841437-23841459 TTGTGGCAAATGAGAGTGAGTGG + Intergenic
904829553 1:33298081-33298103 TTCTGGCAAAGGCGATTGGAAGG + Intronic
905672103 1:39798609-39798631 CTGTGGTAAAGGGTGGTGGATGG + Intergenic
906520563 1:46464613-46464635 TGGTGGCAAGGGAGGGAGAAGGG - Intergenic
907574104 1:55510326-55510348 TGGTGTCAAAGGAGGGTGCTAGG + Intergenic
908114321 1:60925941-60925963 TTCTGGCAGGGAAGGGTGGAGGG - Intronic
909931926 1:81506332-81506354 TTGTTTTAAATGAGGGTGGAGGG + Intronic
911406204 1:97443320-97443342 TTTTGGCAAAGAAAGGAGGATGG + Intronic
911969616 1:104415281-104415303 TTGGGGCAAATGATGGTGGGTGG + Intergenic
911985118 1:104613169-104613191 TTGTGGCAATAGAGAGTGGAGGG - Intergenic
912331944 1:108828010-108828032 GGGAGGCCAAGGAGGGTGGATGG + Intronic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
916756525 1:167775711-167775733 TTATCCCAAAGGAGGGTTGATGG + Intronic
917114762 1:171591763-171591785 TGGTGGCTATGGAGGGTGCAGGG - Exonic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918234677 1:182569356-182569378 TTGAGGGAAAGGAGGGAGGGGGG - Intergenic
919554642 1:199035452-199035474 TAGTAGCAAAGGAGTGAGGAAGG + Intergenic
919774814 1:201187557-201187579 CCGTGGCCAAGGAGGATGGAAGG + Intergenic
920952388 1:210584707-210584729 GTGGGGCAAAGGAGGCTGAAGGG - Intronic
921179245 1:212618785-212618807 TTGTGGGCAAGCAGGGTGGCCGG + Intronic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
923388722 1:233492221-233492243 TTGTGGGAAAGGAGTGAGGCAGG + Intergenic
923576279 1:235161534-235161556 TTGTTGAAAAGGAGGGAGGGAGG + Intronic
923610643 1:235489787-235489809 TGGTGGCAAGGAAGGATGGAAGG - Intronic
924710433 1:246526618-246526640 ATGGGGCAAAGGAGGGAGCATGG + Intergenic
1063288463 10:4715193-4715215 TGGTGAGAAAGGAGAGTGGAGGG - Intergenic
1063933251 10:11050729-11050751 GTCTGGCAATGCAGGGTGGAAGG - Intronic
1064271609 10:13870959-13870981 TTGTGGAACAGAAGGCTGGATGG - Intronic
1066117531 10:32253760-32253782 TTGGGGCACAGGAGGGGGAAAGG + Intergenic
1066446715 10:35490700-35490722 TTGTGCCACAGGAGGCTGGCAGG + Intronic
1067250885 10:44586460-44586482 GTGTGGCAAGGGAGGGAGGGTGG + Intergenic
1067410084 10:46056420-46056442 TGGAGGCAAAGGCGGGTGGATGG + Intergenic
1069506001 10:68998635-68998657 TAGTGGCAAAAGATGGTAGAAGG + Intronic
1070421392 10:76241105-76241127 TTGGGGGAAAGGTGGGTGGGTGG + Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1073250548 10:102118266-102118288 TTGATGCCAAAGAGGGTGGATGG - Intronic
1075651351 10:124129796-124129818 CAGAGGCAAAGGAGGCTGGAGGG + Intergenic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078245281 11:9568835-9568857 TTGTTGCCAAGGAAGGTGAATGG + Intergenic
1078454784 11:11466571-11466593 TTCTGGCAAAGGAGGAAAGAGGG - Intronic
1079005108 11:16786092-16786114 GTGTGGCCTAGGAGGATGGATGG - Intronic
1080047986 11:27829383-27829405 TTGTGGGAAAGCTGGGTGAAGGG + Intergenic
1080840135 11:35976358-35976380 TGGTGGGAAAGGAGGGTAGGAGG + Intronic
1081654422 11:44848180-44848202 TTGTGGGAAAGGAGGATGAGGGG + Intronic
1082222506 11:49656946-49656968 TTGGAGGAAAGGTGGGTGGATGG + Intergenic
1082631008 11:55541952-55541974 GGGAGGCAAAGGAGGGAGGATGG + Intergenic
1084677928 11:70647391-70647413 AGGTGGCACAGGAGGGTGGTTGG + Intronic
1084882820 11:72184033-72184055 GGGTGGCAAAGGTGGGAGGATGG - Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085190035 11:74612101-74612123 TTGGGACTGAGGAGGGTGGAGGG + Intronic
1086438414 11:86803921-86803943 TGGAGGCAAAGGAGGGGGAAAGG - Intronic
1086626544 11:88962260-88962282 TTGGAGGAAAGGTGGGTGGATGG - Intronic
1087749638 11:101993203-101993225 TTGAGGCCATGGAGGGTGGGAGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088311782 11:108467691-108467713 TTGAGGCAAAGGATTTTGGAAGG + Intergenic
1089096229 11:115922302-115922324 TAGGGGCAAAGGAGGTTGAAGGG - Intergenic
1089699072 11:120233677-120233699 TGAGGGCAGAGGAGGGTGGAGGG - Intergenic
1091268381 11:134288355-134288377 TTGTTGCAAAGGAAGGTCAAAGG + Intronic
1091919660 12:4294154-4294176 TGGAGGCAGAGGAGGGTGCAGGG + Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1093997433 12:25656878-25656900 TTGTGGTAAAGGATAGTGGTGGG - Intergenic
1094278543 12:28708060-28708082 TTGTGTCAATGGAGCGTGGATGG - Intergenic
1095954231 12:47797336-47797358 TTCAGGCAAAGGAAGGGGGAAGG - Intronic
1096259383 12:50081434-50081456 TGGTGGCAGAGGCGGGTGGGCGG - Intronic
1096572238 12:52530272-52530294 TTGGGGCAAAGCAATGTGGAGGG - Intergenic
1096836342 12:54353578-54353600 TTGTGGGAAAAGAGGGGGCATGG - Intergenic
1097899425 12:64858185-64858207 TGGTGGGAATGGAGGGTGGGCGG - Intronic
1098040714 12:66351717-66351739 TTGAGGTAAAGGAGGTTGGGTGG + Intronic
1098125928 12:67292847-67292869 TTCTGGCCAAGGAGGGAGGGAGG + Intronic
1098633597 12:72754371-72754393 TTGTGGAAAATGAAGGTAGAGGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1103254283 12:119527433-119527455 TGCTGGAAAAGTAGGGTGGAAGG + Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1103842865 12:123879471-123879493 ATGGGGCAAAGGAGGGTGGGTGG + Intronic
1104054871 12:125221843-125221865 TTGTGGGAAGGGAGATTGGAAGG + Intronic
1105300428 13:19129237-19129259 TGGAGGCCAAGGCGGGTGGATGG + Intergenic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1107945303 13:45412714-45412736 TTATGGAAAAGGAAGATGGAGGG - Intronic
1108475791 13:50816115-50816137 TTGTGGCAAAGGCAGTTAGAAGG + Intronic
1110473356 13:75885538-75885560 CAGAGGCCAAGGAGGGTGGACGG - Intergenic
1110615813 13:77540724-77540746 TTGGGGGAAATGAGGCTGGAGGG + Intronic
1112065736 13:95790783-95790805 TTTGGGCAGAGGAGGGTGGGTGG - Intronic
1112217607 13:97449543-97449565 GTGGGGCAAGGGAGAGTGGATGG - Intronic
1113087462 13:106582875-106582897 TTGTGGCAGTGAAGTGTGGAGGG - Intergenic
1113200015 13:107856743-107856765 TTATGCCAAAGGATGTTGGATGG + Intronic
1113863232 13:113504483-113504505 TTGGGGCAAAGGGTGGTGGGTGG - Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116945884 14:50834812-50834834 TGGGGGCTAAGGTGGGTGGATGG + Intergenic
1117207646 14:53460463-53460485 TCGTGGCATGGGAGGGTAGAGGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1118638582 14:67771121-67771143 TTGAGACAGAGGAGGGTGGAAGG - Intronic
1119935150 14:78585506-78585528 TAGGGACAAGGGAGGGTGGAGGG + Intronic
1120203387 14:81562532-81562554 TGGGGGCAAAGTAGGCTGGAAGG + Intergenic
1120420798 14:84283678-84283700 TTGTGGCATAGGATTGTGGGAGG - Intergenic
1120652081 14:87146665-87146687 TTCAGGCAGATGAGGGTGGAAGG - Intergenic
1124365412 15:29067671-29067693 TTGTGGAAAAGGCGAGAGGATGG - Intronic
1124969581 15:34473190-34473212 CTGTGGCAAGGCAGAGTGGAAGG + Intergenic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129152207 15:73696260-73696282 TTGTGGAAAACATGGGTGGAGGG + Intronic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129746950 15:78028845-78028867 ATGTGGCAAAGGAGGGGGAAGGG + Intronic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1132782459 16:1635280-1635302 TGGTGGCAAGCGAGCGTGGAAGG + Intronic
1134501898 16:14775872-14775894 CAGAGGCCAAGGAGGGTGGATGG - Intronic
1134578663 16:15353022-15353044 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1134723925 16:16404523-16404545 CAGAGGCCAAGGAGGGTGGATGG - Intergenic
1134943505 16:18307347-18307369 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1135818782 16:25660455-25660477 TTGTGGAGTAGGAGGTTGGAAGG - Intergenic
1137017863 16:35394362-35394384 TTGGGACAGCGGAGGGTGGAGGG - Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1138062302 16:53904648-53904670 TTTTGGCAATGGAAGGTGAAGGG + Intronic
1138113825 16:54344694-54344716 TTGTGGCAAAGGTTGGGGGGTGG - Intergenic
1138563661 16:57816833-57816855 TTGAGGCCAGGGAGGTTGGAGGG + Intronic
1139041075 16:62999718-62999740 TTGTCTCAAAGGAGGGGGCATGG - Intergenic
1139933785 16:70552109-70552131 ATGGGGCAAAGAAGGGAGGAGGG - Intronic
1140662413 16:77199970-77199992 GACAGGCAAAGGAGGGTGGAGGG + Exonic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1141860148 16:86710872-86710894 GTGGGGCAGAGGAGGCTGGAGGG + Intergenic
1143380645 17:6494017-6494039 TTGTTGCAAAGGAGTCTGTAGGG - Intronic
1143709424 17:8724120-8724142 TAGAGGCCAAGGTGGGTGGATGG - Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144504357 17:15817460-15817482 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1144634114 17:16893128-16893150 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1144937875 17:18914690-18914712 CTTTGGCAAAAGAGGGTGCATGG - Intronic
1145168211 17:20632969-20632991 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1146164301 17:30575938-30575960 AAGATGCAAAGGAGGGTGGATGG - Intergenic
1146705403 17:34997383-34997405 TCGGGGCAAAGCAGGGTGCAGGG + Intronic
1146832290 17:36080689-36080711 TTGTGACAAAGCAAGGTGGTGGG - Intergenic
1146846775 17:36187012-36187034 TTGTGACAAAGCAAGGTGGTGGG - Intronic
1147547379 17:41412698-41412720 TTGAGGCAAAGGTGAGTGAAAGG + Intergenic
1148468822 17:47880886-47880908 TTGTGGCAGAGGCTGGGGGAGGG - Intergenic
1148518387 17:48244286-48244308 TAGGGGCAAAGGAGGAAGGAAGG - Intronic
1148695748 17:49556969-49556991 GTGGGGCAAAGGGGGCTGGAGGG - Intergenic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149434287 17:56620016-56620038 CTCTGGCAAGGGAGGGTGAACGG - Intergenic
1150233452 17:63573000-63573022 GGGAGGCCAAGGAGGGTGGATGG - Intronic
1150503396 17:65673326-65673348 ATGTGGCAAAAGAGGGCGGGGGG - Intronic
1150559548 17:66282789-66282811 TGGAGGCTAAAGAGGGTGGAGGG - Intergenic
1151767366 17:76139345-76139367 GTGTCCCAATGGAGGGTGGAGGG - Intronic
1151981735 17:77515292-77515314 CAGTGGCAAAGTAGGGTGGTAGG - Intergenic
1152326975 17:79647343-79647365 TTGAGGCAGAGGAGGGTCAAAGG - Intergenic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1153107075 18:1540282-1540304 TGGTGGTAGAGTAGGGTGGAAGG + Intergenic
1153500181 18:5741074-5741096 GTGAGGAAAAGGAGGCTGGAAGG + Intergenic
1153749233 18:8211820-8211842 TTGTGGAAACGAAGGGTGAATGG + Intronic
1153818695 18:8813473-8813495 TAGTGGCAGAGCAGGGTGGGTGG + Intronic
1153954096 18:10081348-10081370 CTCTGGCACAGGAGGCTGGAGGG + Intergenic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1155210734 18:23598472-23598494 TTGTGGCGGCAGAGGGTGGATGG + Intergenic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156229103 18:35136743-35136765 TGGGGGCAAAGGAGAGAGGAAGG - Intronic
1156401154 18:36741815-36741837 TTCTGGCAAAGGAAGGAGCAAGG + Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156580915 18:38373975-38373997 TTTTGGCACATGATGGTGGAGGG + Intergenic
1158660118 18:59379472-59379494 TGGAGGCAGAGGAGGCTGGAAGG + Intergenic
1159005777 18:63009148-63009170 TTGGGGCAAGGAAGGGAGGAAGG - Intergenic
1160479593 18:79226632-79226654 ATGGGGCAAAGGAAGGGGGAAGG - Intronic
1161667524 19:5586190-5586212 TTGGGGCAGAGGATGGTGCATGG - Intergenic
1161705522 19:5819069-5819091 GTGTGGGCAAGCAGGGTGGAGGG + Intergenic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164441692 19:28284449-28284471 GGGAGGAAAAGGAGGGTGGAGGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164441779 19:28284774-28284796 TGGGAGGAAAGGAGGGTGGAAGG + Intergenic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1165462361 19:35951613-35951635 GTGGGGCCATGGAGGGTGGAGGG + Intergenic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1166910475 19:46151668-46151690 TGGAGGCCAAGGAAGGTGGATGG + Intronic
1167412830 19:49355262-49355284 TGGGGGCAAAGGGGGATGGATGG - Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167882308 19:52470258-52470280 TAGAGGCAAAGAAGGGTGGTGGG - Intronic
926740215 2:16104304-16104326 TGGAAGGAAAGGAGGGTGGAAGG + Intergenic
926915434 2:17886788-17886810 CTGTGGCAAAGGTGGGTAGGTGG - Intronic
927151937 2:20201205-20201227 AAATGGCAAAGGAAGGTGGATGG - Exonic
928079914 2:28301690-28301712 TGCTGGCAAAGTAGAGTGGATGG - Intronic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
928194156 2:29202275-29202297 TTTTGGCAAAGGTGGGCGGGGGG - Intronic
928456724 2:31429046-31429068 TAGTGGGAAATGAGGCTGGAAGG - Intergenic
928680378 2:33695119-33695141 TTGCGGGAAAGGAGGGTCTAGGG + Intergenic
929804046 2:45129006-45129028 TTTTGCCAAAGAAGGGAGGAAGG - Intergenic
931697658 2:64883617-64883639 TTATCCCAAAGGAGTGTGGATGG + Intergenic
931909972 2:66888722-66888744 TGGAGGCAAAGGAAGGAGGAAGG + Intergenic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932565210 2:72901849-72901871 GTGTGGCAAAGCAGGGAGGTGGG - Intergenic
932626771 2:73302717-73302739 TTGGGGCAAAAGAGAGAGGAAGG + Intergenic
932833685 2:75014064-75014086 CTGAGGCAAAGAAGGGTTGAAGG - Intergenic
933305463 2:80592344-80592366 TTGGTGCAAAGGAAGCTGGATGG - Intronic
933543175 2:83674346-83674368 TTGTTGCTGAGGAGGGTGCATGG - Intergenic
935059825 2:99597657-99597679 TTGTGGCCAAGGAAGCTGCAAGG + Intronic
935073024 2:99712483-99712505 TTGTGCCAAAGGAGTGAGGAAGG - Intronic
935107603 2:100060093-100060115 TTGAACCAAAGGAGGATGGAGGG - Intronic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
940050574 2:149458335-149458357 TTGTGTCAAAGGAGGCTTAATGG + Intronic
940088295 2:149886479-149886501 CGGAGGCCAAGGAGGGTGGATGG + Intergenic
940120577 2:150260147-150260169 TTTTAGCAAAGGAGGGAGAAGGG + Intergenic
942277608 2:174334555-174334577 TTGTAGGAAAGGAGGCAGGAGGG - Intergenic
942636738 2:178015773-178015795 GAGAGGAAAAGGAGGGTGGAAGG + Intronic
942915490 2:181300849-181300871 GTGTAGCAAAGGATGTTGGAAGG + Intergenic
943597794 2:189878835-189878857 TTGTGTCAAAGCAGGTTGGTAGG + Intergenic
944646243 2:201783426-201783448 CCTTGGCCAAGGAGGGTGGAGGG + Intergenic
945118855 2:206437825-206437847 TTGTGGCTACCAAGGGTGGAGGG + Intergenic
945158677 2:206865651-206865673 GTTTGGAAAAGGAGGCTGGAAGG - Intergenic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
946556199 2:220860405-220860427 AAGTGGCAAAAGAAGGTGGAAGG + Intergenic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
1169281401 20:4270186-4270208 CTCTGGCAAAAGAGGGTGGTGGG - Intergenic
1169556452 20:6755891-6755913 TTGTTGCAAAGAAGGAAGGAAGG - Intergenic
1170131271 20:13022759-13022781 TTGTGGCAGAGGGGAGGGGAGGG - Intronic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1171986707 20:31665869-31665891 TGGTGGCAATGGCGGCTGGACGG + Exonic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172664039 20:36586917-36586939 CTGTGGCAAATGGGGGTGGGAGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172838491 20:37888011-37888033 TTGCAGCAAGGGAGGGTGGTCGG + Intergenic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1173088205 20:39945131-39945153 GTGAGGCAAAGAAAGGTGGAAGG + Intergenic
1173663858 20:44751946-44751968 ATGAGGGAAAGGTGGGTGGATGG + Exonic
1173881583 20:46417087-46417109 TTTAGCCAAAGCAGGGTGGATGG - Intronic
1173999285 20:47362600-47362622 GTGAGCCACAGGAGGGTGGAGGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174387250 20:50194460-50194482 TGGTGACAAAGGAGGGAGCAGGG - Intergenic
1175486315 20:59349065-59349087 ATGAGGCACAGGAGAGTGGAGGG + Intergenic
1176012171 20:62903846-62903868 GTGTGGCAAAGAAGGGAAGAGGG + Intronic
1176588232 21:8611118-8611140 TTGGGTCAGAGGAGGGGGGAGGG + Intergenic
1178627580 21:34231096-34231118 TTGCATCAGAGGAGGGTGGAGGG + Intergenic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1180271064 22:10588117-10588139 TTGGGTCAGAGGAGGGGGGAGGG + Intergenic
1182244545 22:28945450-28945472 GAGAGGCCAAGGAGGGTGGATGG + Intronic
1183534847 22:38394298-38394320 TTGAGACAATGGCGGGTGGAGGG - Intronic
1184159320 22:42688510-42688532 TTCTGGGAAAGGAGGAGGGAGGG + Intergenic
1184289901 22:43493081-43493103 TTGTGACAGAGGAGGATGGGTGG - Intronic
1184306535 22:43606874-43606896 ATGTGGGAAATGAGAGTGGACGG - Intronic
1184689957 22:46113026-46113048 TGGAGGCAAATGAGGATGGAAGG + Intronic
1184745124 22:46451650-46451672 TTGTGGAGAAGGAGGTTGTAGGG - Intronic
1184992040 22:48177223-48177245 ATGAGGCAAAGCAGGGTAGAAGG - Intergenic
1185096463 22:48808628-48808650 TTCTGGCCAAGGAGGCTGCAAGG - Intronic
949272952 3:2241727-2241749 TTGTGTCAAAGGAGGGAACATGG - Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949891727 3:8738266-8738288 CTGTGGCAGATGTGGGTGGAGGG - Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950663485 3:14481369-14481391 TTGAGGCAGATGAGGGAGGAAGG + Intronic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
952219789 3:31313533-31313555 TGGGGGTAAAGGAGAGTGGAGGG - Intergenic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955530431 3:59867048-59867070 TGGTTGTAAAAGAGGGTGGAGGG - Intronic
955692546 3:61604795-61604817 TTGTGGCAAAGTAGGAGAGAAGG + Intronic
956906110 3:73767058-73767080 ACTTGGCGAAGGAGGGTGGAGGG - Intergenic
959674756 3:109021653-109021675 TTGTGGCATAGCATGGTGCAGGG - Intronic
960331738 3:116368056-116368078 TTGTGGTAAATGTGGGTGGGCGG + Intronic
961214113 3:125146619-125146641 TCCTGGCCAAGGATGGTGGAAGG + Intronic
961331109 3:126139005-126139027 TTGTGGCAGAGGTGGGAGGTGGG - Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963774981 3:149429471-149429493 TTGACCAAAAGGAGGGTGGAGGG + Intergenic
964310068 3:155383044-155383066 TTGTGGCACAGTTGGGTGAATGG - Intronic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
968557203 4:1251585-1251607 ATGTGGCAACGGAGGCTGGCCGG - Intergenic
968581198 4:1396181-1396203 TTGTGGCAAGTGTGGGTGGAAGG - Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
970720378 4:18981215-18981237 GTGTGGCAAGGGATAGTGGATGG + Intergenic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973607344 4:52600694-52600716 TTGTGGCTAAAGTGGGTGGCAGG - Intronic
974195954 4:58576014-58576036 TTGTGGCTAAGGAGAGTGAGAGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974442419 4:61937278-61937300 GTGTGGCAAATGAGGCAGGAAGG - Intronic
975119691 4:70715156-70715178 TTCTGGGAAAGGAGGTGGGAGGG + Intronic
977825568 4:101527354-101527376 GTGTGGCAAAGGAGGGGGTAGGG + Intronic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978742686 4:112155035-112155057 TTGTGGCGGGGGAGGGTGGTGGG - Intronic
980532190 4:134070509-134070531 TGGTGGCATAGTGGGGTGGAGGG + Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981538179 4:145822342-145822364 TTGTGACAAACTGGGGTGGAGGG - Intronic
981953999 4:150447853-150447875 TTTGGGAAAAGGAGTGTGGATGG - Intronic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982637777 4:157918705-157918727 TTGTGGGAAAAGACGGTGGGAGG - Intergenic
983690574 4:170464842-170464864 TTGTGGCAAGGGAGACAGGAAGG + Intergenic
985485509 5:146268-146290 GTGTGGGAAAGGAGGGAGGGGGG - Intronic
986141495 5:5034597-5034619 TGGAGGCCAAGGTGGGTGGACGG + Intergenic
986704825 5:10446339-10446361 TTGTCACAACAGAGGGTGGATGG - Intronic
986857455 5:11887324-11887346 TTTTGGCAAAGGTGAGGGGAAGG - Intronic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
988062488 5:26190398-26190420 TTGGGGGATTGGAGGGTGGAGGG + Intergenic
989035669 5:37169205-37169227 CTGTGGCAGAGCAGGTTGGAAGG + Exonic
990051498 5:51507083-51507105 TTGTGGGGAAGGGGGTTGGAGGG - Intergenic
995867363 5:116706055-116706077 TTGAGGGAAAGGAAAGTGGAAGG - Intergenic
996893604 5:128453913-128453935 GTGAGGTACAGGAGGGTGGAAGG - Intronic
997589919 5:135066260-135066282 GTGTGGCCAAGGAGGCGGGAAGG + Intronic
997852738 5:137347101-137347123 TTGGTGCAAGGGAGGGTGGAGGG - Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
999210215 5:149881812-149881834 GGGAGGCCAAGGAGGGTGGATGG + Intronic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1003078976 6:3005837-3005859 TTGAGGCACAGAGGGGTGGAGGG + Intronic
1005136299 6:22571932-22571954 TTGTGGAAAAATAGGGTGAAGGG + Intergenic
1005420954 6:25650496-25650518 ATGTAGCATAGGAGGGTGTAAGG - Intergenic
1006002856 6:30979449-30979471 TTGGTGCAGAGGAGGGTAGAGGG + Intergenic
1006054495 6:31373354-31373376 TGGTGGCAGGGGAGAGTGGAAGG + Intergenic
1006775868 6:36592120-36592142 GGGAGGCAGAGGAGGGTGGATGG + Intergenic
1007259544 6:40554068-40554090 TGGTGGCAATGGAGGGTCGTAGG - Intronic
1007522159 6:42459062-42459084 TTGAGGCACAGGAGGGTTTATGG + Intergenic
1007744622 6:44035857-44035879 TTGTGAGCAAGGAGGGTGCACGG + Intergenic
1008410889 6:51178255-51178277 AAGAAGCAAAGGAGGGTGGAAGG - Intergenic
1010359323 6:74974277-74974299 TTGCGGGAAAGGAGGTTTGATGG - Intergenic
1010951190 6:82039011-82039033 GGGTGACAAAGGAGGCTGGAGGG + Intergenic
1012999519 6:106008493-106008515 TTGTGGCAAAAGAGTGTGAAAGG - Intergenic
1013170082 6:107628968-107628990 GTGAAGCAAAGGAGGATGGAGGG - Intronic
1013635380 6:112024439-112024461 CTGAGGCAAAGGAGGATGCAGGG - Intergenic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015562596 6:134532809-134532831 GTGGGAGAAAGGAGGGTGGAAGG + Intergenic
1015878405 6:137846866-137846888 TCATGGCAGGGGAGGGTGGAGGG + Intergenic
1016752843 6:147650335-147650357 GGGTGGCAAAGGAGGGGGCAAGG + Intronic
1018224455 6:161614902-161614924 TTGTTGCCAAGGGGGATGGAAGG - Intronic
1019184052 6:170210609-170210631 TGGTGGGAAAGGAGAGTGAAGGG + Intergenic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019494460 7:1331302-1331324 TGGGGGCAAAGGAGGCTGGCGGG - Intergenic
1021196464 7:17679713-17679735 TTGGGGCGCAGGAGGGAGGAGGG + Intergenic
1021458267 7:20855240-20855262 ATGCGGCAAAGGAGGGCTGAGGG + Intergenic
1021940212 7:25671628-25671650 TTGTGGCAAATGAGTGAAGAAGG + Intergenic
1022449577 7:30502750-30502772 TGGTGGCAGGGCAGGGTGGATGG - Intronic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024366366 7:48525386-48525408 TTGAGGCAAAGGGGTGTGGGAGG + Intronic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026471751 7:70699865-70699887 TTGTGAGAAAGGAGGGTGATGGG + Intronic
1027135483 7:75621100-75621122 TGGTGGCAGAGGTGGGAGGATGG + Intronic
1028163783 7:87515009-87515031 TGCTTGCAAAGGAGGGTAGAGGG + Intronic
1029480550 7:100809872-100809894 GGGAGGCCAAGGAGGGTGGATGG + Intronic
1029942262 7:104492876-104492898 GAGTGGCAATGGATGGTGGAAGG - Intronic
1031484046 7:122307184-122307206 CTGGGGCAAAGGGGGGTGGGGGG + Intronic
1033225621 7:139559938-139559960 TAGGGGAAAAGGTGGGTGGAGGG + Intergenic
1035257673 7:157642170-157642192 TTGGGGCAAAAGGGGGTGAAGGG - Intronic
1035265827 7:157689986-157690008 GTGTGGGAAAGGAGGAGGGAAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035654056 8:1292274-1292296 TTCTGGCCAAGGAATGTGGAAGG + Intergenic
1037164521 8:15810636-15810658 TTGTGGCCAAGGAGGGGGGGCGG + Intergenic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1039386245 8:37138174-37138196 TTGGGGGAAAGGAGGGTGCAGGG + Intergenic
1039436808 8:37565055-37565077 CGGTGGGAAATGAGGGTGGATGG - Intergenic
1040336463 8:46418541-46418563 GTGTGGCATAGGTGGGTGGCAGG + Intergenic
1042508704 8:69589225-69589247 TTGTGGATACGCAGGGTGGAAGG - Intronic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043250647 8:78068974-78068996 TTGTGGTAAAGTAGGGGGCAAGG - Intergenic
1044372814 8:91433259-91433281 GGGTGGCAAAAGAGGGAGGAGGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044804151 8:95987730-95987752 TTGTGGGGAAGGAGGGTCTATGG - Intergenic
1046340698 8:112851194-112851216 TCTTGGCAAATGAAGGTGGAAGG + Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1049123087 8:140757315-140757337 TTGAGGCAAAGTAGAGTAGAAGG - Intronic
1049141568 8:140959835-140959857 TGTTGGAAAAGGAGGGTGGTGGG - Intronic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1049445711 8:142630401-142630423 TTGGGCCTTAGGAGGGTGGATGG - Intergenic
1050811863 9:9758634-9758656 TTGGGGCAAGGGAGGAAGGAGGG - Intronic
1051819036 9:21143099-21143121 TTTTGTCTAAGGAAGGTGGAAGG + Intergenic
1053141053 9:35682950-35682972 AAGCAGCAAAGGAGGGTGGAAGG + Intronic
1053385722 9:37686186-37686208 TTGGGGCAAAGGAGACTGAAAGG + Intronic
1054848239 9:69820108-69820130 TGGTGGCAATGGATGATGGACGG + Intergenic
1055652419 9:78419335-78419357 AAGTGGCAAAGGAGGATGGATGG + Intergenic
1056287696 9:85107977-85107999 TGGTGACACAGGAGGGAGGATGG + Intergenic
1056660036 9:88536399-88536421 CTGTTGCAAAGGAGGGGGTAGGG + Intronic
1056791747 9:89630236-89630258 TTCTGGAAAAGGAGGAGGGATGG - Intergenic
1057851275 9:98568574-98568596 TTGGGGCAAATGAGGTGGGAGGG + Intronic
1057998026 9:99837895-99837917 TTGTGGGAATGGGAGGTGGAGGG + Intronic
1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG + Intergenic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1060467724 9:123922171-123922193 GGGAGGCCAAGGAGGGTGGATGG - Intronic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061240995 9:129372308-129372330 TTGTGGCAAGGCAGGGGGGCAGG + Intergenic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062454452 9:136629103-136629125 TGGGGGCCAAGGAGGGTGGGCGG - Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1203618246 Un_KI270749v1:89704-89726 TTGAGTCAGAGGAGGGGGGAGGG + Intergenic
1186216020 X:7302134-7302156 TTGTTTCAAAGGAGGGTGTATGG + Intronic
1188425832 X:30045667-30045689 GGGAGGCAAAGGCGGGTGGATGG - Intergenic
1188482417 X:30649223-30649245 TGGAGGCTGAGGAGGGTGGATGG + Intergenic
1188894025 X:35644150-35644172 TTGAAGAAAAGGAGGTTGGAAGG - Intergenic
1189384552 X:40526761-40526783 TTGTGGGAAAAGAAGCTGGATGG - Intergenic
1189485779 X:41430646-41430668 TGGTGGGAATGGAGGGTGGGGGG - Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1193085783 X:77447212-77447234 TTTTGGGAGAGGGGGGTGGAGGG - Intergenic
1195345891 X:103950893-103950915 TAGTGGGAAAGGAGAGTGGCTGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195885073 X:109629205-109629227 TCGTGGAAAATGGGGGTGGAGGG - Intronic
1197790451 X:130248955-130248977 GTATGGCAGAGGAGGGTGGGCGG - Intronic
1198540970 X:137639433-137639455 TTGGGGCGAGGGTGGGTGGAAGG + Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199257357 X:145732079-145732101 TTGTAGTAAAGGAGTCTGGATGG + Intergenic