ID: 1101201201

View in Genome Browser
Species Human (GRCh38)
Location 12:102438217-102438239
Sequence AGAAGACCGCAGAGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101201201_1101201205 23 Left 1101201201 12:102438217-102438239 CCTGCCTTCCTCTGCGGTCTTCT 0: 1
1: 0
2: 3
3: 29
4: 350
Right 1101201205 12:102438263-102438285 TCGACGACTGGCCTGCACATTGG 0: 1
1: 0
2: 0
3: 4
4: 35
1101201201_1101201206 30 Left 1101201201 12:102438217-102438239 CCTGCCTTCCTCTGCGGTCTTCT 0: 1
1: 0
2: 3
3: 29
4: 350
Right 1101201206 12:102438270-102438292 CTGGCCTGCACATTGGCTGCTGG 0: 1
1: 0
2: 0
3: 25
4: 217
1101201201_1101201204 11 Left 1101201201 12:102438217-102438239 CCTGCCTTCCTCTGCGGTCTTCT 0: 1
1: 0
2: 3
3: 29
4: 350
Right 1101201204 12:102438251-102438273 TCTTCAGAGACATCGACGACTGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101201201 Original CRISPR AGAAGACCGCAGAGGAAGGC AGG (reversed) Intronic
900075213 1:809671-809693 AGATGGCAGCAGGGGAAGGCTGG - Intergenic
902378404 1:16041277-16041299 AGAAGGGAGCAGAGGAACGCTGG - Intergenic
902883019 1:19385352-19385374 AGAAGAAAGGAGAGGAGGGCAGG + Intronic
903299508 1:22368665-22368687 AGAAGAGCCCAGAGGTTGGCCGG + Intergenic
903312527 1:22470892-22470914 AGAAGACAGCAAAGGAAGTTAGG - Intronic
904256091 1:29255833-29255855 GGAAGAGGGCAGAGGAAGGAAGG - Intronic
904280844 1:29417221-29417243 AGAACACCCCAGATGCAGGCGGG + Intergenic
904917084 1:33977803-33977825 AAATGACCCAAGAGGAAGGCTGG - Intronic
906119085 1:43375640-43375662 AGAGGAAAGCAGAAGAAGGCAGG + Intergenic
906373485 1:45274454-45274476 TGAAGACTGGAGAGGGAGGCAGG + Intronic
906922010 1:50074731-50074753 TGAAGACACTAGAGGAAGGCAGG + Intronic
906945808 1:50293203-50293225 AAAAGAAGGCAGAGGAAGGAAGG + Intergenic
907304008 1:53503814-53503836 AGTAGGCCGCAGGGGATGGCAGG - Intergenic
907435428 1:54442873-54442895 AGAAGATGGCTGAAGAAGGCCGG - Intergenic
907443255 1:54491075-54491097 ATAAGGCTGCAGAGGCAGGCAGG - Intergenic
907469588 1:54664576-54664598 ATAAGGCTGCAGAGGAGGGCAGG + Intronic
908218547 1:61980051-61980073 AGAAAACAGCAGAGGCAGGAAGG - Intronic
909753498 1:79193586-79193608 AGCAGCCCGCAGAGTAAGGCAGG + Intergenic
910427069 1:87129029-87129051 AGAAGACAGCCGAGGCATGCAGG + Intronic
911124062 1:94323779-94323801 AGAAAACCCCAGAGGCAGGAAGG + Intergenic
912370782 1:109172534-109172556 TGAAGACCACAGAGAAAGGATGG + Exonic
912570952 1:110620522-110620544 AGAAGGCCAGAGAGGAGGGCTGG + Intronic
912860772 1:113211800-113211822 AGAAGACAGGAGAGGAAGTGGGG + Intergenic
916450873 1:164919224-164919246 AGAGGAAAGCAGTGGAAGGCAGG + Intergenic
916771580 1:167914041-167914063 AGAAGACAGGAGAGGAGGCCGGG + Exonic
917716061 1:177739267-177739289 AGAAGTCTGGAGAGGGAGGCTGG + Intergenic
918437361 1:184529724-184529746 AGAAGACAGCAGTGGAAGGAAGG + Intronic
918511411 1:185317419-185317441 AGTAGACCAGGGAGGAAGGCGGG - Intergenic
921602555 1:217122030-217122052 ACAACACCTTAGAGGAAGGCAGG + Intronic
922191499 1:223322958-223322980 GGAAGGCCACAGAGGAAAGCAGG + Intronic
922271053 1:224034568-224034590 AGATGGCAGCAGGGGAAGGCTGG - Intergenic
922502846 1:226109926-226109948 GGAGGAGCGCAGAGGAGGGCGGG + Intergenic
922998331 1:229984650-229984672 AGAAGACAGCAAGTGAAGGCAGG - Intergenic
923565718 1:235074377-235074399 AGAAGAACCCAGGCGAAGGCAGG + Intergenic
923724608 1:236495418-236495440 CGAAGAGAGCAGAGGAAAGCAGG - Intergenic
923741002 1:236654946-236654968 AGAAGAAAGAAAAGGAAGGCAGG - Intergenic
924505535 1:244680099-244680121 AAAAGAAGGCAGAGGAAGGGTGG - Intronic
1063473068 10:6304438-6304460 AGTAGCCCGCAGAGGATGGCTGG - Intergenic
1064395941 10:14982019-14982041 AGAAAACTGCAGAAGCAGGCTGG - Intronic
1065060310 10:21894272-21894294 AGAAAATAGAAGAGGAAGGCTGG + Intronic
1066779206 10:38924897-38924919 AGCAGACCTCAGAGAAAGCCTGG + Intergenic
1067128145 10:43537768-43537790 AGAAGAAGGAAGAGGAAGGAAGG - Intergenic
1068558228 10:58482076-58482098 AGAAGAAGGCAGAGGAGGGAAGG - Intergenic
1068586192 10:58801666-58801688 ATAAGACAGCAGAGGAAATCAGG - Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070329314 10:75406400-75406422 GGAAGAGCGCAGAAAAAGGCGGG - Intergenic
1070336619 10:75461473-75461495 AGAAAACAGCAGAAGCAGGCAGG - Intronic
1072494691 10:95945275-95945297 AGAAGATAGAAGAGAAAGGCAGG - Intergenic
1073048965 10:100655921-100655943 AGAAAAGGGAAGAGGAAGGCTGG - Intergenic
1073117763 10:101101614-101101636 ACAAGACCAGAGAAGAAGGCAGG + Intronic
1073469485 10:103714002-103714024 AGAATGCAACAGAGGAAGGCTGG + Intronic
1074605703 10:114962930-114962952 AGAAGACAGCAGCAGAAGGCAGG - Intronic
1074768006 10:116714729-116714751 AAGAGACTGCAGAGGAAGGTGGG - Intronic
1074914005 10:117938415-117938437 AGAAGAGTGAAGAGGAGGGCAGG - Intergenic
1074936281 10:118184668-118184690 AGAAGACTGGAGAGGTAGCCTGG + Intergenic
1075434871 10:122429956-122429978 TGAGGACGGCAGAGGCAGGCAGG - Exonic
1075798574 10:125137933-125137955 AGAAGACCCCAGGGGACCGCGGG + Intronic
1076915411 10:133420983-133421005 AGAAGAGGGAAGAGGAAGGAAGG + Exonic
1076986843 11:243544-243566 AGAAGACCACTGTGGAAGGAAGG - Intronic
1077278997 11:1733475-1733497 AGAAACCTGCAGAGGAAGGGAGG - Exonic
1078062856 11:8059674-8059696 GGGAGACAGCAGAGCAAGGCAGG + Intronic
1079375587 11:19888830-19888852 AAAAGACCCCAGAGCAAGTCTGG - Intronic
1079512557 11:21228599-21228621 ATAAAACTGCAGAGAAAGGCTGG - Intronic
1079541278 11:21578466-21578488 ACAAGGCTGAAGAGGAAGGCTGG + Intergenic
1080761978 11:35259715-35259737 AGAAGACTGAGGAGGAAGACTGG + Exonic
1080933670 11:36839347-36839369 AGAAGACAGCAGAGGCAGTGTGG + Intergenic
1081296086 11:41391192-41391214 AGAACACTGAAGAAGAAGGCAGG - Intronic
1081918237 11:46748236-46748258 AGAAAAGAACAGAGGAAGGCAGG + Intronic
1082735313 11:56848507-56848529 AGATGCCTGCAGAGGAAGTCTGG - Intergenic
1083619555 11:64042210-64042232 GGAAGACAGGAGAGGAAGGTGGG - Intronic
1083725807 11:64627392-64627414 AGGAGGGTGCAGAGGAAGGCGGG - Intronic
1083832837 11:65243946-65243968 AGCAGCACGCAGAGGTAGGCAGG - Intergenic
1084261513 11:67981863-67981885 AGAAAACTGCAGAAGCAGGCTGG - Intergenic
1084811131 11:71612245-71612267 AGAAGACTGCAGAAGCAGGCTGG + Intergenic
1085738501 11:79059973-79059995 AGATGACCGGTGAGGGAGGCAGG - Intronic
1085782950 11:79425776-79425798 AGTGGACCCCAGAGGCAGGCAGG - Intronic
1088665937 11:112093729-112093751 AGCAGAGATCAGAGGAAGGCAGG - Intronic
1089697736 11:120226321-120226343 AGAAGACAGCAGGAGCAGGCCGG - Intronic
1090029629 11:123195727-123195749 AGAAGAGCGCAGAGGACAGAGGG - Intergenic
1090703370 11:129315638-129315660 TGAAGACCCAGGAGGAAGGCTGG - Intergenic
1091287142 11:134413705-134413727 AGAAGAAGGCGGAGCAAGGCTGG - Intergenic
1092733919 12:11561177-11561199 AGAAAACCACAGAGGTAGGCTGG - Intergenic
1093654958 12:21683970-21683992 AGTAGACTGAAGAGGGAGGCTGG - Intronic
1096577414 12:52561723-52561745 AGAAGTCCTCAAAGGCAGGCTGG - Intergenic
1099613650 12:84909156-84909178 AGAAGACAGTAGAAGAAAGCGGG - Intronic
1100342911 12:93698148-93698170 AGAAGACAGCATAAGCAGGCAGG - Intronic
1100616762 12:96236911-96236933 AGAAGCCAGAAGAGGAAGGGGGG - Intronic
1100896926 12:99193227-99193249 AGAAGACTGCAGAAGCAGGAAGG + Intronic
1101201201 12:102438217-102438239 AGAAGACCGCAGAGGAAGGCAGG - Intronic
1101392429 12:104314138-104314160 ATGAGACCAGAGAGGAAGGCAGG + Intronic
1102055802 12:109895593-109895615 ACAAGACCGCAGAAGTAGACAGG - Intergenic
1102675961 12:114659213-114659235 AAAGGACAGCAGAGAAAGGCTGG + Intergenic
1102997181 12:117360150-117360172 AGAAGGCAGCCGAGGAGGGCAGG - Intronic
1104374323 12:128250527-128250549 ACAAGAAGGCAGAGGAAGGGCGG + Intergenic
1104709296 12:130974124-130974146 AGGATACAGCAGAGGAAAGCGGG - Intronic
1104803673 12:131571515-131571537 AGGAGTCCGCATAGGAAGGCTGG - Intergenic
1105754210 13:23449897-23449919 AGCAGTCCGCTGAGGGAGGCAGG - Intergenic
1106246829 13:27957486-27957508 AGAAGACAGCAGATGAGGCCGGG + Intergenic
1107242598 13:38254785-38254807 GGAAGACCTCAGAGAAAGCCTGG - Intergenic
1108270765 13:48757210-48757232 AGAAGTCAGCTGAGGAGGGCTGG - Intergenic
1108416649 13:50204329-50204351 AGCAGACTGCAGAGAAAGGAAGG + Intronic
1108455882 13:50612871-50612893 GGAAGACCTCTGAGGCAGGCAGG - Intronic
1110399281 13:75070831-75070853 AGAAGACAGCAGAGGAAGACTGG + Intergenic
1110976638 13:81844345-81844367 AGAAGTCTGCAAAGGAAGCCGGG + Intergenic
1113726156 13:112603853-112603875 AGAAGAGGGCAGAGGGAGGATGG + Intergenic
1116277585 14:42856230-42856252 AGAAAACAGCAGAGGAAGTCAGG + Intergenic
1118797200 14:69153606-69153628 AGAGGCCAGCAGAGGAAGGAGGG - Intergenic
1119077431 14:71656140-71656162 AAAAGACCTCAGAAAAAGGCTGG + Intronic
1119825103 14:77651170-77651192 AGAACAAAGCAGAGGATGGCAGG - Intergenic
1120921518 14:89760152-89760174 AGTAGACTGCAGGGGAAAGCTGG + Intergenic
1121008920 14:90508568-90508590 AGAGAACACCAGAGGAAGGCAGG - Intergenic
1121614763 14:95306054-95306076 TGAAGCCATCAGAGGAAGGCAGG + Intronic
1121685529 14:95832386-95832408 GGAAGATGGCAGAGGAAGGTGGG - Intergenic
1122055546 14:99095922-99095944 AGCAGAGGGCAGGGGAAGGCTGG - Intergenic
1123215955 14:106809654-106809676 AGAAGACAGCAGGGGCATGCAGG + Intergenic
1123800194 15:23811154-23811176 AGCAGGCGGCAGAGGAAGGAGGG + Intergenic
1123813685 15:23955080-23955102 GGAGGACTGCAGAGGGAGGCAGG + Intergenic
1123992145 15:25691617-25691639 AGTAGAGCCCAGAGGAAGTCGGG + Intronic
1125578257 15:40769261-40769283 GGAGGACCCCAGAGGAAGCCCGG + Intronic
1126753093 15:51897405-51897427 AGAAAACAGCAGAGAAAAGCAGG - Intronic
1127310309 15:57746300-57746322 ATAAGGCCGCAGAGAAAGGATGG - Intronic
1129380395 15:75161404-75161426 AGAGGATGGCAGAGTAAGGCTGG - Intergenic
1129858275 15:78840720-78840742 AGAAGACTGGAGAGGGAGCCTGG - Intronic
1132388674 15:101422013-101422035 AGAAAAGGGCAGAGGTAGGCAGG + Intronic
1132494256 16:253322-253344 AGAAGTCCGCAGGGGAGGACAGG - Intronic
1132502210 16:289584-289606 ACAAGATCGCAGAGGAAGGTGGG - Exonic
1132544852 16:528262-528284 AGAGGAACCCAGAGGAAGGCGGG + Intronic
1132785759 16:1656328-1656350 AGAAGACCCCTGCAGAAGGCAGG + Exonic
1133162379 16:3920580-3920602 AGAAGCAGGCAGAGGACGGCCGG - Intergenic
1138128059 16:54455034-54455056 AGAAGAGAGCTGAAGAAGGCAGG - Intergenic
1139496996 16:67326988-67327010 AGAAAACTGAAGTGGAAGGCGGG + Intronic
1139599511 16:67978154-67978176 AGGGGTCCGCAGAGGGAGGCTGG - Intronic
1140070992 16:71649447-71649469 AGAAGGTAGCAGAAGAAGGCTGG + Exonic
1140445956 16:75028132-75028154 AGCAGAGAGCAGAGGAAGGTTGG - Intronic
1140486802 16:75299975-75299997 AGAAGAGGACAGAGGTAGGCAGG + Intronic
1140682084 16:77395123-77395145 AGAAGAGACCTGAGGAAGGCTGG + Intronic
1141508278 16:84495434-84495456 AGCAGACTGCAGGGGAAGGAGGG - Intronic
1141985339 16:87576292-87576314 AGAAGTCCGCAGGGGGAGCCGGG + Intergenic
1142123272 16:88397426-88397448 AGAAGACTGCTGAGGAAGGCTGG + Intergenic
1143624611 17:8102558-8102580 AGCAGAGCGGAGAGGAAGGTAGG - Intronic
1145708508 17:26945565-26945587 AGCAGACCTCAGAGAAAGCCTGG + Intergenic
1146397661 17:32481575-32481597 AGAAGAGAGGAGAGGAATGCAGG - Exonic
1146547930 17:33755120-33755142 ATGAGAGGGCAGAGGAAGGCAGG + Intronic
1146644987 17:34571404-34571426 TGAGGACTGCAGAGGAAGCCGGG - Intergenic
1146702713 17:34975361-34975383 AGAAGAAAGCAGAGGAGGGTGGG - Intronic
1146953121 17:36920406-36920428 AGGAGACCGCACAGGCAGGAAGG - Intergenic
1146986657 17:37226611-37226633 AGAAGATCCCAGAGGAAGTTTGG + Intronic
1147121603 17:38338317-38338339 AGCAGACCTCAGAGCCAGGCAGG + Intronic
1150314139 17:64154745-64154767 GGAAGATCACAGAGGAAGGAAGG + Intronic
1151635351 17:75343828-75343850 AGAAGAAAGGAGAGGAAGGGAGG + Intronic
1151803050 17:76388954-76388976 AGGAGACAGCTGAGGGAGGCTGG - Intergenic
1152731882 17:81976667-81976689 AGGAGTCCGCAGAGACAGGCAGG + Intergenic
1152805504 17:82353973-82353995 AGAAGGCCAGAGAGGAAGGATGG - Intergenic
1152924970 17:83083001-83083023 AGAAGACGTCAGGTGAAGGCCGG + Intronic
1153309249 18:3661897-3661919 AGAAGACTGCTGGTGAAGGCTGG + Intronic
1157418012 18:47521969-47521991 AGAAAACAGCAGAGGCAGGAAGG + Intergenic
1159364754 18:67451215-67451237 TGAAGTCTGCAGAGGCAGGCAGG + Intergenic
1160586140 18:79914667-79914689 AGAAGACCACACAGCAAGGGGGG + Intronic
1160698615 19:496225-496247 GGAAGATCGCAGACGGAGGCCGG - Intronic
1161009188 19:1951974-1951996 AGAAAACAGCAGAGAATGGCCGG - Intronic
1161076618 19:2288902-2288924 AGCTGACCACAGAGGCAGGCAGG - Intronic
1161284729 19:3463371-3463393 CGGAGACCGCAGAGGCGGGCAGG + Intronic
1161420862 19:4175301-4175323 AACGGACCGCAGAGGAGGGCAGG - Intronic
1161688033 19:5713261-5713283 AGAAGAGCACAGAGGAATGTTGG + Intronic
1161707724 19:5829842-5829864 AGAAGACTGCGGGGGTAGGCGGG - Intergenic
1162195140 19:8978952-8978974 AGATGACAACAGAGGAATGCTGG + Exonic
1162439311 19:10682824-10682846 AGAAGTCCGCACAGGAAGCTGGG + Intronic
1163966760 19:20753347-20753369 AGAAAACTGCAGAAAAAGGCTGG - Intronic
1166318660 19:42003202-42003224 AGAAGGGGGCAGAGGAATGCAGG - Intronic
1166953511 19:46446332-46446354 AGGAGACAGCAGAAGAGGGCTGG + Intergenic
1166996311 19:46721235-46721257 AGAAGAGGGGAGAGGACGGCAGG + Intronic
1167598621 19:50440714-50440736 AGAAGACCCCAGGAGGAGGCTGG + Intronic
926010052 2:9400307-9400329 AGAAGGGAGCAGAGGAAGGCAGG - Intronic
926069223 2:9871836-9871858 AGAAGACCGGAGGGGAATGGGGG + Intronic
927210367 2:20635320-20635342 AGAAACCAGCAGAGGAAGGAGGG + Intronic
927283913 2:21336465-21336487 TGAAGCCCACAGAGGCAGGCAGG - Intergenic
928689578 2:33785308-33785330 ATAAGACAGCAGAGGGAAGCAGG - Intergenic
930594568 2:53371109-53371131 AGAAGACTAGAAAGGAAGGCTGG - Intergenic
930696805 2:54420064-54420086 AGAAGACGGCAGAAGCAGCCAGG + Intergenic
930719931 2:54629071-54629093 AGATGGCAGAAGAGGAAGGCTGG + Exonic
930878728 2:56248445-56248467 AGAAGACAGCACAGGAAGGGAGG - Intronic
931835882 2:66097941-66097963 AGAAGCCCACAGAGGAGGGCAGG + Intergenic
932343092 2:70978921-70978943 AGAAGCCAGCAGAGACAGGCTGG + Intronic
932433581 2:71689865-71689887 AGAGGACGGCAGAGGAAGTGGGG + Intergenic
934610311 2:95730606-95730628 AGAGGCCCGCAGAGGCAGACTGG + Intergenic
935148949 2:100417013-100417035 AGGAGCATGCAGAGGAAGGCAGG - Intronic
935462696 2:103356731-103356753 AGAAAACAGCAGAGGTAGGAAGG - Intergenic
935672900 2:105570782-105570804 AGGAGGCCGCAGAGGAAAGCTGG - Intergenic
936543641 2:113372192-113372214 AGAGGCCCGCAGAGGCAGACTGG + Intergenic
936577644 2:113669241-113669263 AGGAGACCGCAGGGGAAGCTCGG + Intergenic
937872088 2:126793174-126793196 AGAAGGCTGCAGAGGGAGGTGGG + Intergenic
937937719 2:127259495-127259517 AGGAGAAGGCAGAGGAGGGCTGG - Intronic
939190418 2:138911283-138911305 ATAAGACTGGAGAGGTAGGCAGG + Intergenic
940006420 2:149012762-149012784 AGAAGATGGCAGATGATGGCAGG - Intronic
941354186 2:164468475-164468497 AGAAAACCGCAGTGGGAGGAAGG - Intergenic
942698284 2:178672593-178672615 AAAAGACAGAAGAGGAAGTCAGG + Intronic
947004549 2:225495860-225495882 AGAAGACCGCAGACCAAATCTGG + Intronic
947065618 2:226221605-226221627 ATAAGACCAGAAAGGAAGGCAGG - Intergenic
947150612 2:227111406-227111428 AGAAGACAGAAGAGGAAGGCAGG + Intronic
947339214 2:229119860-229119882 AGAAAAATGCAGAGGAAGGTTGG + Intronic
947507282 2:230717845-230717867 TTAAGCCTGCAGAGGAAGGCAGG + Intronic
948281818 2:236752885-236752907 AGAAGACAGCAGAGGAGGGGAGG - Intergenic
948431059 2:237919362-237919384 AGAAGAGAGCAGATGTAGGCTGG + Intergenic
949082507 2:242115115-242115137 AGATGGCAGCAGGGGAAGGCTGG + Intergenic
1169075793 20:2759221-2759243 AGAAGGTCGGGGAGGAAGGCTGG - Intronic
1169321134 20:4634275-4634297 AGATGACAGCAGAGGAGGGATGG - Intergenic
1169745046 20:8935080-8935102 AGAAAACGGCCCAGGAAGGCTGG - Intronic
1170664935 20:18378603-18378625 AGAAAACCACAAAGGGAGGCTGG + Intergenic
1171115827 20:22524098-22524120 AGAGGACGGCACAGGAGGGCTGG - Intergenic
1171374993 20:24686311-24686333 AGCAGACCTCAGACAAAGGCTGG - Intergenic
1171467210 20:25338191-25338213 AGGAGGCCGCAGAGGAACACAGG - Intronic
1172271442 20:33657770-33657792 AGAAGGCTCCAGAGGGAGGCAGG + Exonic
1173600216 20:44289639-44289661 AGCAGAGCCCAGAGGAAAGCAGG + Intergenic
1174168910 20:48604301-48604323 AGAAGACCCCAGGGCAAGTCAGG + Intergenic
1174484358 20:50851849-50851871 AGGGGACCCCAGAGGAAGGCTGG - Intronic
1174992809 20:55531028-55531050 AGAAGACTGCAGAGAAAATCAGG - Intergenic
1175718413 20:61270866-61270888 AAAACACCCCAGAGGAAGACAGG - Intronic
1175791720 20:61744241-61744263 AGAATAACAGAGAGGAAGGCAGG + Intronic
1176191004 20:63809539-63809561 AGAAGAGGGGAGAGGAAGGGAGG - Intronic
1178081781 21:29073626-29073648 GGAAGACCGCGGAGGAAGCGAGG + Exonic
1178887677 21:36496660-36496682 AGAAGAAAGCAGAGGAAGGAAGG + Intronic
1179015934 21:37594603-37594625 AGAAGGAAGCAGAGGAGGGCCGG + Intergenic
1179076084 21:38123128-38123150 AGAAAAACGGAGAGGAAGGGAGG - Intronic
1180054195 21:45348792-45348814 AGGAGAACCCAGAGGAGGGCTGG - Intergenic
1180320018 22:11311207-11311229 AGAAGAAGGTAGAGGAAGGAAGG - Intergenic
1180377811 22:12111418-12111440 TGAAGCCTGCAGAGGCAGGCAGG + Intergenic
1180716930 22:17878147-17878169 AGAAGAAGGGAGGGGAAGGCCGG - Intronic
1180746405 22:18092087-18092109 AGAGGACGGCACAGGGAGGCTGG - Exonic
1181897096 22:26120028-26120050 AGAACATCGCAGAAGAAGGCTGG - Intergenic
1183039522 22:35166197-35166219 TGAAGTCTGCAGAGGCAGGCAGG - Intergenic
1183580836 22:38725800-38725822 AGAAGGCCTCAGAGTAGGGCTGG + Intronic
1184412330 22:44332343-44332365 GGAAGAACGCAGAGGAAGGAAGG - Intergenic
1184815421 22:46865176-46865198 ATAAGACTGGAGAGGAAGGCAGG - Intronic
1184856358 22:47148741-47148763 AGAAGAACCCAGAGGAGGGAGGG - Intronic
1185422588 22:50743423-50743445 AGGAGACCGCAGGGGAAGCTCGG - Intronic
1203290657 22_KI270735v1_random:34945-34967 AGCAGACCTCAGAGAAAGCCTGG - Intergenic
949882637 3:8674024-8674046 AGAAAACTGCAGAAGCAGGCTGG + Intronic
950085203 3:10252543-10252565 AGATGACCACAGAGCAAGGGAGG - Intronic
950087477 3:10270483-10270505 TGGAGGCCTCAGAGGAAGGCTGG + Exonic
951532389 3:23710012-23710034 AGAAGAGAGGAGAGGAAGTCAGG - Intergenic
953905511 3:46866482-46866504 ACAAGAGCCCAGAAGAAGGCCGG - Intronic
957051426 3:75415186-75415208 AGAAGGCAGCTGAGGATGGCAGG - Intergenic
957076587 3:75607435-75607457 AGAAAACTGCAGAAGCAGGCTGG - Intergenic
958517676 3:95139473-95139495 AGAAGAAATCATAGGAAGGCTGG - Intergenic
959297601 3:104557007-104557029 TGAGGACAGCAGAGGAAGTCAGG - Intergenic
960364045 3:116749146-116749168 AGAACACAGGGGAGGAAGGCAGG + Intronic
961364918 3:126393584-126393606 ATAAGGCTGCAGAGGTAGGCTGG + Intergenic
962922991 3:139967260-139967282 AGAAGAAAGCAGAGGATGGCAGG - Intronic
963926697 3:150958508-150958530 GTAAGACTGGAGAGGAAGGCAGG - Intronic
963932200 3:151015020-151015042 AGAAATACGCAGAAGAAGGCTGG - Intergenic
964499390 3:157331579-157331601 AGATGACTGCAGAGGACCGCAGG + Intronic
965614300 3:170577321-170577343 AGAAAACCACAGAGGAGGCCGGG + Intronic
967683887 3:192397380-192397402 AGAAGACTACAGAGGATGTCTGG + Intronic
968036234 3:195550325-195550347 AGGGGACTGCAGAGGAAAGCTGG + Intergenic
968460285 4:721411-721433 AGAGCTCCCCAGAGGAAGGCTGG + Intronic
969020041 4:4133730-4133752 AGAAAACTGCAGAAGCAGGCTGG - Intergenic
969070788 4:4537027-4537049 AGAGCACCGCACAGGAAAGCAGG - Intronic
969154377 4:5197099-5197121 AGATGTCTGCAGGGGAAGGCAGG + Intronic
969317349 4:6390208-6390230 AGAACACAGCAGAGGGAGGCTGG + Intronic
969733813 4:8973682-8973704 AGAAAACTGCAGAAGCAGGCTGG + Intergenic
969793402 4:9507740-9507762 AGAAAACTGCAGAAGCAGGCTGG + Intergenic
971485675 4:27157557-27157579 AGCAGATGGCAGAGGAAGGATGG + Intergenic
974091952 4:57320934-57320956 AGGAGAAAGCAGAGGAAGGAAGG - Intergenic
974329286 4:60455789-60455811 TGAGGACCTCAGAGGGAGGCAGG - Intergenic
975167076 4:71188143-71188165 ATAAGTCACCAGAGGAAGGCAGG + Intronic
975232191 4:71948103-71948125 TGAAGTCTGCAGAGGCAGGCAGG - Intergenic
975372722 4:73607282-73607304 AGGAGGCTGAAGAGGAAGGCAGG - Intronic
984262008 4:177453476-177453498 AGAGGAGAGCAGAGGAAGGGAGG - Intergenic
985168144 4:187119259-187119281 AGAAGACTGCAGTAGAAGACTGG + Intergenic
1202759424 4_GL000008v2_random:96879-96901 TGAAGCCTGCAGAGGCAGGCAGG + Intergenic
986644264 5:9901114-9901136 AGAAGACCACAGAGAAGGGTAGG + Intergenic
987260029 5:16194112-16194134 AGAAAACAGCAGAGGCAGGAAGG - Intergenic
988800860 5:34695418-34695440 AGAGGACGCCAGAGAAAGGCTGG - Intronic
988919343 5:35926131-35926153 AGAAGAATGGATAGGAAGGCGGG + Intronic
989452039 5:41597793-41597815 AGTAAAAGGCAGAGGAAGGCTGG - Intergenic
989606160 5:43246199-43246221 AGAAGACCACAGAAGGCGGCTGG - Intronic
992391037 5:76331164-76331186 AGAACACCTCAGAAGAAAGCGGG - Intronic
992798408 5:80273822-80273844 GGAAGACCACAGAGGGAGGATGG - Intergenic
993696230 5:91065271-91065293 AGGAGACCTCTGAGGGAGGCTGG + Intronic
994510042 5:100690862-100690884 AGGAGAGGGCAGAGGAAGGGAGG - Intergenic
996261498 5:121475935-121475957 AGAAGAATGCAGAGGCAGGAGGG + Intergenic
998234449 5:140386143-140386165 AGAAAATGGCAGAGGAAGCCGGG - Intergenic
998250868 5:140551332-140551354 AGAAGACAGCAGGGAAAGGAAGG - Intronic
999120855 5:149208447-149208469 TGAAGACAGCAGAGAAAGACAGG - Intronic
1001140292 5:169138420-169138442 AGAAGACAGGGGAGGAAGCCAGG - Intronic
1001287932 5:170437319-170437341 AGAAAACCACAGAAGAAGGAAGG - Intronic
1001549827 5:172594812-172594834 AGCAGCCCTCTGAGGAAGGCAGG - Intergenic
1003414246 6:5893887-5893909 AAAAGACTGCCGTGGAAGGCAGG - Intergenic
1005006620 6:21293611-21293633 AGAAGATCGCAGAGACATGCAGG - Intergenic
1005976200 6:30801631-30801653 AGAAGTGGGCAGAGGAAGGGAGG + Intergenic
1006069843 6:31490472-31490494 AGAAGTCCTCTGAAGAAGGCGGG + Intergenic
1006196179 6:32243879-32243901 AGAAGCCCCGTGAGGAAGGCAGG - Intergenic
1007500110 6:42290284-42290306 AGAACATGACAGAGGAAGGCAGG + Intronic
1010916828 6:81630051-81630073 AGAAAACTCCAGAGGAGGGCAGG - Intronic
1011066444 6:83331646-83331668 TGAAGACACCAGAGGAAGACGGG + Intronic
1011780579 6:90785078-90785100 ATAAGATTGGAGAGGAAGGCTGG - Intergenic
1013620529 6:111883958-111883980 AGCAGAAGGCAGAGGAAGCCGGG + Intergenic
1013852106 6:114528476-114528498 AGAAGGCTGCCGAGGAAGTCAGG - Intergenic
1016558607 6:145368910-145368932 AGAAAACCGCAGAAGCAGGAAGG - Intergenic
1017325471 6:153136617-153136639 AGAAGCCCTCAGTGGAAGGCAGG + Intergenic
1018170291 6:161139004-161139026 AGGCGCCCCCAGAGGAAGGCAGG + Intronic
1019350005 7:550150-550172 AGAAGCCCACAGAGGCAGCCGGG + Exonic
1019416961 7:932262-932284 GGAAGGCTGGAGAGGAAGGCTGG - Intronic
1019416965 7:932275-932297 TGATGGCCGGAGAGGAAGGCTGG - Intronic
1019488287 7:1299398-1299420 AGAGGTCCGGAGAGGAGGGCTGG + Intergenic
1020307449 7:6845765-6845787 AGAAAACTGCAGAAGCAGGCTGG - Intergenic
1020311926 7:6874591-6874613 AGAAAACTGCAGAAGCAGGCTGG - Intergenic
1022013739 7:26330584-26330606 AGGAGAGGGCAGAGGAAGGACGG + Intronic
1022139284 7:27478931-27478953 TGGAGACAGAAGAGGAAGGCAGG + Intergenic
1023421623 7:39985969-39985991 AGAAGGAGGCAGAGAAAGGCTGG - Intronic
1023641985 7:42268377-42268399 AGAAGGCCTTAGAGGAAGGAGGG - Intergenic
1026568640 7:71510659-71510681 AGAAGAATGGAGAGGAAGCCTGG - Intronic
1029078572 7:97954704-97954726 AGAAAACTGCAGAAGCAGGCTGG - Intergenic
1032799844 7:135309188-135309210 AGAAGAAGGAAGAGGAAGGAAGG + Intergenic
1033066850 7:138164288-138164310 AGAAGACAGCAGAAGCAGGAAGG + Intergenic
1033144197 7:138856946-138856968 AGAAAAAGACAGAGGAAGGCTGG + Intronic
1034393089 7:150800947-150800969 AGGGGACTGCAGAGGAAGCCAGG + Exonic
1035293253 7:157853457-157853479 AGAAGACGGCAAAGGGAGGTGGG - Intronic
1035540428 8:431819-431841 AGATGGCAGCAGGGGAAGGCTGG + Intronic
1036007735 8:4686375-4686397 AGAAAACTGCAGAGGCAGGAAGG + Intronic
1036751694 8:11447569-11447591 AGTAGCCCCCAGAGGCAGGCGGG + Intronic
1036817014 8:11909838-11909860 AGAAAACTGCAGAAAAAGGCTGG - Intergenic
1037806427 8:22060122-22060144 AGAGCACCACAGAGGAAGGCAGG - Intronic
1037963573 8:23117120-23117142 GGAACACAGCAGAGGGAGGCAGG - Exonic
1038834911 8:31108810-31108832 AGGAGAAGGGAGAGGAAGGCAGG + Intronic
1039197336 8:35047337-35047359 ACAAGACCACAGAGGTAGGCTGG + Intergenic
1039225067 8:35379244-35379266 AGAAGACTGAAGAGAAAGTCAGG - Intronic
1039439385 8:37584250-37584272 GGAAGACTGAAGAGGAAGGAGGG + Intergenic
1041954443 8:63542059-63542081 ATGAGACAGAAGAGGAAGGCAGG - Intergenic
1042840555 8:73119459-73119481 TGAAGACTGCTGAAGAAGGCTGG - Intronic
1042852759 8:73233148-73233170 AGAAGACAGAAGAGGAAGAAAGG - Intergenic
1042959462 8:74288170-74288192 AGAAGAGGGCAGATGGAGGCGGG + Intronic
1043590640 8:81829475-81829497 AGAAAACCCCAGAAGAAAGCTGG - Exonic
1044157007 8:88860236-88860258 TGAAGCCTGCAGAGGCAGGCAGG + Intergenic
1044536270 8:93359508-93359530 AGAAGCCCGCACAGGGAGGTGGG - Intergenic
1044674041 8:94711956-94711978 AGAAAGCAACAGAGGAAGGCTGG - Intergenic
1044928229 8:97227250-97227272 AGAGGACCTCAGAGGAAGAAGGG + Intergenic
1045003774 8:97900268-97900290 AGAACATCAAAGAGGAAGGCTGG + Intronic
1045862837 8:106832147-106832169 AGAAGGCAGCATAGGCAGGCGGG - Intergenic
1047184671 8:122622000-122622022 ACAAAAAGGCAGAGGAAGGCTGG + Intergenic
1047268713 8:123333539-123333561 AGAAGTCTGCCAAGGAAGGCAGG + Intronic
1048822178 8:138390746-138390768 AGCAGAAGGCAGAGGAAGGTGGG + Intronic
1049451974 8:142666833-142666855 AGAAGCCATCAGAGGAAGCCAGG + Intronic
1049694661 8:143977355-143977377 TGGAGCCCGCAGAGGGAGGCAGG + Exonic
1049985677 9:948557-948579 AGCAGAGCGCAGGGGAAGGATGG - Intronic
1050442859 9:5683745-5683767 TGGAGACTGCTGAGGAAGGCGGG + Intronic
1051146596 9:14033711-14033733 AGAAGATCGCAGATAAATGCAGG + Intergenic
1053284638 9:36842287-36842309 AGGTGAGCCCAGAGGAAGGCGGG + Intronic
1053584239 9:39439473-39439495 AGAGGACCTCAGAAGAAGGTGGG + Intergenic
1054105819 9:60998219-60998241 AGAGGACCTCAGAAGAAGGTGGG + Intergenic
1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG + Intronic
1054773139 9:69101558-69101580 AAAAGTACGCATAGGAAGGCTGG + Intergenic
1055771101 9:79717857-79717879 AGAAGACGCCAGTGGCAGGCAGG - Intronic
1056810882 9:89762987-89763009 AGAAGACTGCAGAGAGAGGGAGG - Intergenic
1057971305 9:99560855-99560877 GGAAGAAAGCAGAGGCAGGCAGG - Intergenic
1059367352 9:113797005-113797027 AGGAGACCGGAGAGCTAGGCTGG + Intergenic
1059403267 9:114083958-114083980 AGAAGACAGCTGAGGGAGACTGG + Intergenic
1059445583 9:114335994-114336016 AGAAGCCACCAGAGGGAGGCAGG + Exonic
1060247090 9:121956360-121956382 AGAAACCCGCATAGAAAGGCAGG + Intronic
1062145193 9:134985199-134985221 AGGAGGCAGCAGAGGAAGGCGGG - Intergenic
1062397358 9:136357853-136357875 ACAAGACCCCAGAGCGAGGCAGG + Intronic
1062527169 9:136982636-136982658 AGAAGGCCGAAGAGGCAGGATGG + Intronic
1203540200 Un_KI270743v1:81774-81796 TGAAGCCTGCAGAGGCAGGCAGG + Intergenic
1186147560 X:6640544-6640566 AGAAGACAGCAGAATAAGACAGG + Intergenic
1187538684 X:20168479-20168501 TGAAAACTACAGAGGAAGGCAGG + Intronic
1187663061 X:21572618-21572640 GGAAAACCGCAGAGCAAAGCGGG + Intronic
1188308432 X:28586996-28587018 AGAAGACCGAAGTGGAAGGAAGG - Intergenic
1188567592 X:31544393-31544415 AGAAGACAGCAGAAGCAGGATGG + Intronic
1189128594 X:38475011-38475033 AAAAGTCTGGAGAGGAAGGCAGG - Intronic
1189346428 X:40245144-40245166 GGAAGACAGCAGAGGAAAGCAGG - Intergenic
1189586507 X:42467607-42467629 CGAAGACCCCAGAGGTGGGCAGG + Intergenic
1191996591 X:67102201-67102223 ATAAGACCAAAGAGAAAGGCAGG - Intergenic
1193473942 X:81940756-81940778 TGGAGACTGCAGAGGTAGGCAGG - Intergenic
1195021652 X:100834222-100834244 AGAAGTACGCAGAGGAAGGGGGG - Intronic
1195328452 X:103776887-103776909 AAAAGACCGAAGAAGGAGGCTGG + Exonic
1195898463 X:109772698-109772720 AGAAGCCCTCAGTGGTAGGCAGG + Intergenic
1198429862 X:136554439-136554461 AGAAGTCTGGAGAGGTAGGCAGG + Intronic
1199671366 X:150150939-150150961 GGAAGAACCCAGAGGTAGGCAGG - Intergenic
1200775207 Y:7164440-7164462 AGAAGAAAGCAGAGGGAGGAAGG - Intergenic
1200947957 Y:8864998-8865020 AGAAAACTGCAGAAAAAGGCTGG + Intergenic
1201070457 Y:10143303-10143325 AGAAGAAAGTAGAGGAAGGAAGG + Intergenic
1201146288 Y:11067099-11067121 AGAAGAAGGGAGAGGAAGGGAGG + Intergenic
1201146390 Y:11067413-11067435 AGAAGAAGGGAGAGGAAGGGAGG + Intergenic