ID: 1101207402

View in Genome Browser
Species Human (GRCh38)
Location 12:102502301-102502323
Sequence TCCTTCCCAGGTTTGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101207402_1101207405 18 Left 1101207402 12:102502301-102502323 CCCTTTAGCAAACCTGGGAAGGA No data
Right 1101207405 12:102502342-102502364 TACTGCTGATTACAGATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101207402 Original CRISPR TCCTTCCCAGGTTTGCTAAA GGG (reversed) Intergenic
No off target data available for this crispr