ID: 1101211328

View in Genome Browser
Species Human (GRCh38)
Location 12:102537995-102538017
Sequence TGTTAAGGAAATAACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101211321_1101211328 8 Left 1101211321 12:102537964-102537986 CCCTGTCTCAAAAAAAAAAAAAA 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
Right 1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG No data
1101211320_1101211328 17 Left 1101211320 12:102537955-102537977 CCATGGAGACCCTGTCTCAAAAA No data
Right 1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG No data
1101211322_1101211328 7 Left 1101211322 12:102537965-102537987 CCTGTCTCAAAAAAAAAAAAAAT 0: 467
1: 15885
2: 21266
3: 37065
4: 67863
Right 1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101211328 Original CRISPR TGTTAAGGAAATAACTTGGG AGG Intergenic
No off target data available for this crispr