ID: 1101215398

View in Genome Browser
Species Human (GRCh38)
Location 12:102576626-102576648
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101215398_1101215399 -10 Left 1101215398 12:102576626-102576648 CCATGGAGAAATAGAGATCTGGA No data
Right 1101215399 12:102576639-102576661 GAGATCTGGATTGCAGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101215398 Original CRISPR TCCAGATCTCTATTTCTCCA TGG (reversed) Intergenic
No off target data available for this crispr