ID: 1101217621

View in Genome Browser
Species Human (GRCh38)
Location 12:102600572-102600594
Sequence TTTCAATTTGCTCCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101217621_1101217625 15 Left 1101217621 12:102600572-102600594 CCTGGGTTTGGAGCAAATTGAAA No data
Right 1101217625 12:102600610-102600632 TCAGGTCCTGCCTCTGACCTTGG No data
1101217621_1101217624 -3 Left 1101217621 12:102600572-102600594 CCTGGGTTTGGAGCAAATTGAAA No data
Right 1101217624 12:102600592-102600614 AAAATTAAGGGTTTTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101217621 Original CRISPR TTTCAATTTGCTCCAAACCC AGG (reversed) Intergenic
No off target data available for this crispr