ID: 1101225639

View in Genome Browser
Species Human (GRCh38)
Location 12:102685645-102685667
Sequence CTGGGTAAACTGATTGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101225634_1101225639 16 Left 1101225634 12:102685606-102685628 CCAAACTTCACATACAGTGGAAG No data
Right 1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101225639 Original CRISPR CTGGGTAAACTGATTGTTCA TGG Intergenic
No off target data available for this crispr