ID: 1101229044

View in Genome Browser
Species Human (GRCh38)
Location 12:102721019-102721041
Sequence CAGTGTTTCCACATGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101229044_1101229053 24 Left 1101229044 12:102721019-102721041 CCTATCTCCATGTGGAAACACTG No data
Right 1101229053 12:102721066-102721088 CTTTTAGCTGCTCTCCTCTGGGG No data
1101229044_1101229052 23 Left 1101229044 12:102721019-102721041 CCTATCTCCATGTGGAAACACTG No data
Right 1101229052 12:102721065-102721087 TCTTTTAGCTGCTCTCCTCTGGG No data
1101229044_1101229054 29 Left 1101229044 12:102721019-102721041 CCTATCTCCATGTGGAAACACTG No data
Right 1101229054 12:102721071-102721093 AGCTGCTCTCCTCTGGGGTCAGG No data
1101229044_1101229051 22 Left 1101229044 12:102721019-102721041 CCTATCTCCATGTGGAAACACTG No data
Right 1101229051 12:102721064-102721086 CTCTTTTAGCTGCTCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101229044 Original CRISPR CAGTGTTTCCACATGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr