ID: 1101229480

View in Genome Browser
Species Human (GRCh38)
Location 12:102725266-102725288
Sequence CCTGTAATAAGTCCAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101229480_1101229482 24 Left 1101229480 12:102725266-102725288 CCTGATTTTGGACTTATTACAGG No data
Right 1101229482 12:102725313-102725335 GTGTTAAACCACTAAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101229480 Original CRISPR CCTGTAATAAGTCCAAAATC AGG (reversed) Intergenic
No off target data available for this crispr