ID: 1101231663

View in Genome Browser
Species Human (GRCh38)
Location 12:102747726-102747748
Sequence GACCCAGTGGGAGATCATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101231663_1101231668 -8 Left 1101231663 12:102747726-102747748 CCCCTATGATCTCCCACTGGGTC No data
Right 1101231668 12:102747741-102747763 ACTGGGTCCCTCCCATGACATGG 0: 9
1: 33
2: 78
3: 144
4: 328
1101231663_1101231671 -5 Left 1101231663 12:102747726-102747748 CCCCTATGATCTCCCACTGGGTC No data
Right 1101231671 12:102747744-102747766 GGGTCCCTCCCATGACATGGGGG No data
1101231663_1101231669 -7 Left 1101231663 12:102747726-102747748 CCCCTATGATCTCCCACTGGGTC No data
Right 1101231669 12:102747742-102747764 CTGGGTCCCTCCCATGACATGGG 0: 10
1: 37
2: 83
3: 200
4: 409
1101231663_1101231675 3 Left 1101231663 12:102747726-102747748 CCCCTATGATCTCCCACTGGGTC No data
Right 1101231675 12:102747752-102747774 CCCATGACATGGGGGAATTATGG 0: 3
1: 140
2: 909
3: 2696
4: 5011
1101231663_1101231678 30 Left 1101231663 12:102747726-102747748 CCCCTATGATCTCCCACTGGGTC No data
Right 1101231678 12:102747779-102747801 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
1101231663_1101231677 29 Left 1101231663 12:102747726-102747748 CCCCTATGATCTCCCACTGGGTC No data
Right 1101231677 12:102747778-102747800 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1101231663_1101231670 -6 Left 1101231663 12:102747726-102747748 CCCCTATGATCTCCCACTGGGTC No data
Right 1101231670 12:102747743-102747765 TGGGTCCCTCCCATGACATGGGG 0: 227
1: 579
2: 2014
3: 3679
4: 5803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101231663 Original CRISPR GACCCAGTGGGAGATCATAG GGG (reversed) Intergenic
No off target data available for this crispr