ID: 1101232657

View in Genome Browser
Species Human (GRCh38)
Location 12:102756969-102756991
Sequence CCCCCCGGGAGACTTTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101232657_1101232663 21 Left 1101232657 12:102756969-102756991 CCCCTGCAAAGTCTCCCGGGGGG No data
Right 1101232663 12:102757013-102757035 AGCACAAGATGTGTTTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101232657 Original CRISPR CCCCCCGGGAGACTTTGCAG GGG (reversed) Intergenic
No off target data available for this crispr