ID: 1101237195

View in Genome Browser
Species Human (GRCh38)
Location 12:102801851-102801873
Sequence CAAGTGGAGCAATTAGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101237195_1101237201 -4 Left 1101237195 12:102801851-102801873 CCCATATCTAATTGCTCCACTTG No data
Right 1101237201 12:102801870-102801892 CTTGTGGCCACAGGCCCTGAGGG No data
1101237195_1101237206 15 Left 1101237195 12:102801851-102801873 CCCATATCTAATTGCTCCACTTG No data
Right 1101237206 12:102801889-102801911 AGGGCCCGAAGTTTTTATCTGGG No data
1101237195_1101237205 14 Left 1101237195 12:102801851-102801873 CCCATATCTAATTGCTCCACTTG No data
Right 1101237205 12:102801888-102801910 GAGGGCCCGAAGTTTTTATCTGG No data
1101237195_1101237200 -5 Left 1101237195 12:102801851-102801873 CCCATATCTAATTGCTCCACTTG No data
Right 1101237200 12:102801869-102801891 ACTTGTGGCCACAGGCCCTGAGG No data
1101237195_1101237207 16 Left 1101237195 12:102801851-102801873 CCCATATCTAATTGCTCCACTTG No data
Right 1101237207 12:102801890-102801912 GGGCCCGAAGTTTTTATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101237195 Original CRISPR CAAGTGGAGCAATTAGATAT GGG (reversed) Intergenic
No off target data available for this crispr