ID: 1101238374

View in Genome Browser
Species Human (GRCh38)
Location 12:102813003-102813025
Sequence GGGTTAATATATATAAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101238368_1101238374 29 Left 1101238368 12:102812951-102812973 CCTCAGCTGAAAAATAGGTCAAT No data
Right 1101238374 12:102813003-102813025 GGGTTAATATATATAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101238374 Original CRISPR GGGTTAATATATATAAAACT TGG Intergenic
No off target data available for this crispr