ID: 1101238887

View in Genome Browser
Species Human (GRCh38)
Location 12:102818270-102818292
Sequence CCTACTGAGGAGAGGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101238887_1101238893 10 Left 1101238887 12:102818270-102818292 CCCTCTATCCTCTCCTCAGTAGG No data
Right 1101238893 12:102818303-102818325 AGATCCCCCAGTAGGCTGAATGG No data
1101238887_1101238898 20 Left 1101238887 12:102818270-102818292 CCCTCTATCCTCTCCTCAGTAGG No data
Right 1101238898 12:102818313-102818335 GTAGGCTGAATGGCCATCTGTGG No data
1101238887_1101238899 29 Left 1101238887 12:102818270-102818292 CCCTCTATCCTCTCCTCAGTAGG No data
Right 1101238899 12:102818322-102818344 ATGGCCATCTGTGGTGTCCTTGG No data
1101238887_1101238900 30 Left 1101238887 12:102818270-102818292 CCCTCTATCCTCTCCTCAGTAGG No data
Right 1101238900 12:102818323-102818345 TGGCCATCTGTGGTGTCCTTGGG No data
1101238887_1101238892 2 Left 1101238887 12:102818270-102818292 CCCTCTATCCTCTCCTCAGTAGG No data
Right 1101238892 12:102818295-102818317 CTCTTACTAGATCCCCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101238887 Original CRISPR CCTACTGAGGAGAGGATAGA GGG (reversed) Intergenic
No off target data available for this crispr