ID: 1101241593

View in Genome Browser
Species Human (GRCh38)
Location 12:102844614-102844636
Sequence GGTGGTTCCCGCCCACAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101241593_1101241600 0 Left 1101241593 12:102844614-102844636 CCTCATTGTGGGCGGGAACCACC 0: 1
1: 0
2: 4
3: 36
4: 313
Right 1101241600 12:102844637-102844659 CAATGGGCTGGAATCCCAGATGG 0: 1
1: 0
2: 1
3: 40
4: 653
1101241593_1101241604 16 Left 1101241593 12:102844614-102844636 CCTCATTGTGGGCGGGAACCACC 0: 1
1: 0
2: 4
3: 36
4: 313
Right 1101241604 12:102844653-102844675 CAGATGGAAGAAAAAGGCAGAGG 0: 1
1: 5
2: 49
3: 202
4: 948
1101241593_1101241601 10 Left 1101241593 12:102844614-102844636 CCTCATTGTGGGCGGGAACCACC 0: 1
1: 0
2: 4
3: 36
4: 313
Right 1101241601 12:102844647-102844669 GAATCCCAGATGGAAGAAAAAGG 0: 1
1: 0
2: 4
3: 39
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101241593 Original CRISPR GGTGGTTCCCGCCCACAATG AGG (reversed) Intronic