ID: 1101241600

View in Genome Browser
Species Human (GRCh38)
Location 12:102844637-102844659
Sequence CAATGGGCTGGAATCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 653}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101241593_1101241600 0 Left 1101241593 12:102844614-102844636 CCTCATTGTGGGCGGGAACCACC 0: 1
1: 0
2: 4
3: 36
4: 313
Right 1101241600 12:102844637-102844659 CAATGGGCTGGAATCCCAGATGG 0: 1
1: 0
2: 1
3: 40
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101241600 Original CRISPR CAATGGGCTGGAATCCCAGA TGG Intronic