ID: 1101241601

View in Genome Browser
Species Human (GRCh38)
Location 12:102844647-102844669
Sequence GAATCCCAGATGGAAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101241593_1101241601 10 Left 1101241593 12:102844614-102844636 CCTCATTGTGGGCGGGAACCACC 0: 1
1: 0
2: 4
3: 36
4: 313
Right 1101241601 12:102844647-102844669 GAATCCCAGATGGAAGAAAAAGG 0: 1
1: 0
2: 4
3: 39
4: 398
1101241597_1101241601 -8 Left 1101241597 12:102844632-102844654 CCACCCAATGGGCTGGAATCCCA 0: 1
1: 0
2: 12
3: 664
4: 23050
Right 1101241601 12:102844647-102844669 GAATCCCAGATGGAAGAAAAAGG 0: 1
1: 0
2: 4
3: 39
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101241601 Original CRISPR GAATCCCAGATGGAAGAAAA AGG Intronic