ID: 1101241601 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:102844647-102844669 |
Sequence | GAATCCCAGATGGAAGAAAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 442 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 39, 4: 398} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1101241593_1101241601 | 10 | Left | 1101241593 | 12:102844614-102844636 | CCTCATTGTGGGCGGGAACCACC | 0: 1 1: 0 2: 4 3: 36 4: 313 |
||
Right | 1101241601 | 12:102844647-102844669 | GAATCCCAGATGGAAGAAAAAGG | 0: 1 1: 0 2: 4 3: 39 4: 398 |
||||
1101241597_1101241601 | -8 | Left | 1101241597 | 12:102844632-102844654 | CCACCCAATGGGCTGGAATCCCA | 0: 1 1: 0 2: 12 3: 664 4: 23050 |
||
Right | 1101241601 | 12:102844647-102844669 | GAATCCCAGATGGAAGAAAAAGG | 0: 1 1: 0 2: 4 3: 39 4: 398 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1101241601 | Original CRISPR | GAATCCCAGATGGAAGAAAA AGG | Intronic | ||