ID: 1101241604

View in Genome Browser
Species Human (GRCh38)
Location 12:102844653-102844675
Sequence CAGATGGAAGAAAAAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1205
Summary {0: 1, 1: 5, 2: 49, 3: 202, 4: 948}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101241598_1101241604 -5 Left 1101241598 12:102844635-102844657 CCCAATGGGCTGGAATCCCAGAT 0: 1
1: 0
2: 4
3: 317
4: 1453
Right 1101241604 12:102844653-102844675 CAGATGGAAGAAAAAGGCAGAGG 0: 1
1: 5
2: 49
3: 202
4: 948
1101241599_1101241604 -6 Left 1101241599 12:102844636-102844658 CCAATGGGCTGGAATCCCAGATG 0: 1
1: 0
2: 2
3: 43
4: 911
Right 1101241604 12:102844653-102844675 CAGATGGAAGAAAAAGGCAGAGG 0: 1
1: 5
2: 49
3: 202
4: 948
1101241593_1101241604 16 Left 1101241593 12:102844614-102844636 CCTCATTGTGGGCGGGAACCACC 0: 1
1: 0
2: 4
3: 36
4: 313
Right 1101241604 12:102844653-102844675 CAGATGGAAGAAAAAGGCAGAGG 0: 1
1: 5
2: 49
3: 202
4: 948
1101241597_1101241604 -2 Left 1101241597 12:102844632-102844654 CCACCCAATGGGCTGGAATCCCA 0: 1
1: 0
2: 12
3: 664
4: 23050
Right 1101241604 12:102844653-102844675 CAGATGGAAGAAAAAGGCAGAGG 0: 1
1: 5
2: 49
3: 202
4: 948

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101241604 Original CRISPR CAGATGGAAGAAAAAGGCAG AGG Intronic