ID: 1101241832

View in Genome Browser
Species Human (GRCh38)
Location 12:102846852-102846874
Sequence GGTGGATGGTGGAGTGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101241832_1101241838 -9 Left 1101241832 12:102846852-102846874 CCTATAGCACTCCACCATCCACC 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1101241838 12:102846866-102846888 CCATCCACCCAGGGAGAGAAGGG 0: 1
1: 0
2: 0
3: 28
4: 269
1101241832_1101241836 -10 Left 1101241832 12:102846852-102846874 CCTATAGCACTCCACCATCCACC 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1101241836 12:102846865-102846887 ACCATCCACCCAGGGAGAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 235
1101241832_1101241843 27 Left 1101241832 12:102846852-102846874 CCTATAGCACTCCACCATCCACC 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1101241843 12:102846902-102846924 AGCTTTTCAATGTATTCATCAGG 0: 1
1: 0
2: 4
3: 23
4: 251
1101241832_1101241842 2 Left 1101241832 12:102846852-102846874 CCTATAGCACTCCACCATCCACC 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1101241842 12:102846877-102846899 GGGAGAGAAGGGACTTACTGTGG 0: 1
1: 0
2: 1
3: 33
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101241832 Original CRISPR GGTGGATGGTGGAGTGCTAT AGG (reversed) Intronic
900385602 1:2409209-2409231 TGTGGTTGGTGGAGAGCCATGGG - Intronic
901446864 1:9313807-9313829 AGTGAATGGAGGAGTGTTATCGG + Intronic
903927749 1:26842915-26842937 GGTGCATGGTGGAGGGCTGGGGG + Intronic
904452225 1:30621172-30621194 GGTGGGTGGGGGATTGCTGTGGG - Intergenic
910342508 1:86203793-86203815 GGTGGAAGCTGGAGTGCAGTAGG - Intergenic
910360976 1:86413480-86413502 GGTGGATGATGGTGGACTATCGG - Intergenic
913625104 1:120652127-120652149 GGTGGTTGGTGGAGGGGTCTAGG + Intergenic
915673474 1:157509871-157509893 GGTGGATGGAGGAGAGCTGGGGG - Intergenic
917773268 1:178303972-178303994 GGTGGATTCTGGAGTGCCAGTGG + Intronic
918127242 1:181595518-181595540 GGAGGATGGTGGAGAGATACAGG - Intronic
918805546 1:189036866-189036888 GGAGTATGATGGAGAGCTATGGG - Intergenic
921066350 1:211625178-211625200 GGTGAATGGAGGAGTGCGGTGGG + Intergenic
922272211 1:224043997-224044019 GGGGGAGGGAGGAGTGCTAGTGG - Intergenic
1063231129 10:4066818-4066840 GGTGGTAGGTGGGGTGCTCTGGG - Intergenic
1063687216 10:8248528-8248550 GGTGGAAGGGGGACTGCTACTGG + Intergenic
1065919393 10:30378845-30378867 TGTGGATGGTGAAGTGCTGATGG + Intergenic
1074086362 10:110210963-110210985 GGTAGATGCTGGAATCCTATCGG - Intronic
1074832630 10:117260227-117260249 GGTGAAGGCTGGAGTGCTAGGGG + Intronic
1074872777 10:117590093-117590115 GGTGGGTGGTGGGGTGCTTTGGG + Intergenic
1075054136 10:119205873-119205895 CGTGGTTGGTGGAGGGCTCTAGG + Intergenic
1075686206 10:124366989-124367011 GGTGGATCCTGCAGTGCTCTGGG + Intergenic
1080792161 11:35531130-35531152 GGTGCATGGTGGTGTGCTGGAGG + Intergenic
1081522627 11:43897965-43897987 GATGGAAGGTGGAGTCCAATGGG - Intronic
1090502130 11:127271374-127271396 GGTGGATGGGGAAGTCCTCTTGG - Intergenic
1092690493 12:11104036-11104058 GTTGGATGGGGGAGTGGTAGTGG - Intronic
1093439617 12:19178879-19178901 AGTGGCTGGTGGAGTGCTGTTGG + Intronic
1093619229 12:21267120-21267142 AGTGGGTGTTGGAGTGCTTTGGG - Exonic
1095942709 12:47737288-47737310 GGTGGAGAGTGGAGTGCGCTGGG - Exonic
1096840105 12:54374795-54374817 GGTGGATGGTGGAAGACTAGAGG - Intronic
1097300573 12:58014459-58014481 GCTGGATGCTGGAATGCTGTTGG - Intergenic
1098112760 12:67140869-67140891 GGTGCCTGGTGGAGTACTACAGG + Intergenic
1098838209 12:75446385-75446407 GAAGGCTGGCGGAGTGCTATAGG + Intergenic
1101241832 12:102846852-102846874 GGTGGATGGTGGAGTGCTATAGG - Intronic
1101303125 12:103502195-103502217 GGTGGAGGGTGGAGTGTTTCAGG - Intergenic
1101843934 12:108346650-108346672 GGGGGCTGGTGGAGTTCTCTGGG - Intergenic
1102617090 12:114164169-114164191 GGTGGTAGGTGGGGTGATATTGG - Intergenic
1103735538 12:123058541-123058563 GGTGAATGGTGGAGTGAGAGAGG - Intronic
1103875172 12:124121520-124121542 GTTGGATGGTTGAGTGCATTGGG + Intronic
1103948698 12:124540613-124540635 GGTGGGAGGTGGAGAGCTAGAGG + Intronic
1104295317 12:127506561-127506583 TGTTGAAGTTGGAGTGCTATTGG - Intergenic
1104983606 12:132584740-132584762 TGTGGATGGTGCAGTGTTCTTGG + Exonic
1105748057 13:23395517-23395539 GGTGGATGGTGGAGAAGTAGGGG - Intronic
1108711578 13:53038207-53038229 GGGGGGTGGGCGAGTGCTATTGG - Intronic
1108845484 13:54674417-54674439 GGTGGATGGTCAATTGCTAATGG + Intergenic
1109759416 13:66807951-66807973 GCTGGGTGGTTGAGTGTTATGGG + Intronic
1111612105 13:90617688-90617710 GGTGGATGAAGGAGGACTATCGG - Intergenic
1111697785 13:91647263-91647285 AGTGCATGGTGAAGTTCTATAGG + Intronic
1112238296 13:97656179-97656201 GGTTCCTGGTGGAGTGCCATAGG - Intergenic
1113680306 13:112238998-112239020 GGGGGATGGGGGAGTGCTGGGGG - Intergenic
1118104710 14:62644825-62644847 GGTGGATGGGGGAGTGGTGGTGG - Intergenic
1119664751 14:76477346-76477368 GATGAATGTTGAAGTGCTATGGG + Intronic
1122244944 14:100395814-100395836 GGTGGGTGGGGGAGTGCAGTTGG - Intronic
1124262727 15:28206958-28206980 GGAGTATGGTGGTGTGATATTGG - Intronic
1125484531 15:40103111-40103133 GGTGGTCGGAGGAGAGCTATTGG - Intronic
1125572500 15:40731715-40731737 GGTAGATGGTGAAGGGCTAATGG - Intronic
1126742611 15:51792859-51792881 TGTGGAGGGTGGGGTGCTAGGGG + Intronic
1133815081 16:9190870-9190892 TGGGGAGGGTGGAGTGCTACTGG + Intergenic
1136073831 16:27804911-27804933 GGAGGCTGGGGGAGTGCTACGGG + Intronic
1137760452 16:50935990-50936012 GGGGGGTGGTGGAGTGAAATTGG + Intergenic
1138789773 16:59889541-59889563 AGTGGTTGGGGGAGTGCTGTGGG + Intergenic
1140422793 16:74834465-74834487 GCTGGGTGGTGGAGGGCCATTGG - Intergenic
1141421520 16:83920948-83920970 GATGGATGGTGGAGGGTTAATGG + Exonic
1144779342 17:17800010-17800032 GGTGGAGGGTGGAGTGAGGTGGG - Intronic
1146712419 17:35054128-35054150 GGTGGAAGGTGGAGAAGTATGGG - Intronic
1148139862 17:45320609-45320631 GGTGGATGAGGGAGTGCTATAGG - Intergenic
1155077397 18:22371757-22371779 GCTGGATAGTGGTGAGCTATGGG + Intergenic
1161974058 19:7599268-7599290 GGTGGATGGATGAGTGCAGTGGG - Intronic
1161974104 19:7599435-7599457 GGTGGATGGATGAGTGCAGTGGG - Intronic
1167111736 19:47466404-47466426 GGGGGGTGGTGGGGTCCTATGGG + Exonic
925076452 2:1020226-1020248 GGTGGATGGTGGAGGACTCCAGG + Intronic
925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG + Intronic
930724421 2:54668424-54668446 GCTGGATGCTGGCGTGCTCTGGG - Exonic
931431947 2:62215467-62215489 GGCAGATGGTGGAGTGATAAGGG - Intronic
931817726 2:65921223-65921245 GGTCCAAGGGGGAGTGCTATGGG - Intergenic
932918635 2:75884045-75884067 GGTAGAGGATGGAGTGTTATGGG + Intergenic
937849363 2:126619248-126619270 GCTGGCTTGTGGAGTGCTAATGG - Intergenic
937872929 2:126798803-126798825 GGTGGAGGGTGGTGTGGTGTGGG - Intergenic
939024196 2:136992500-136992522 GGGGGATGGAGAAGTGATATAGG + Intronic
939933222 2:148257949-148257971 GGTGGATGATGGTGGACTATTGG - Intronic
940562277 2:155313626-155313648 GGTGAATAGTTGAGTGCGATGGG - Intergenic
940635996 2:156297622-156297644 GTTTGATGGTGGAGTGAAATGGG - Intergenic
942955286 2:181766021-181766043 GGTGGTTGGTGGGGGGCTAGGGG - Intergenic
944127622 2:196312241-196312263 GATGGGTGGGGGGGTGCTATGGG + Intronic
944531522 2:200672682-200672704 GGTTGATGCTTGAGTGCTAAGGG + Intronic
946716218 2:222556928-222556950 GGTGGATGGGGGAGGACTAAGGG - Intronic
948458682 2:238118905-238118927 GGTGGATGGAGGAGGGTTAATGG + Intronic
948458697 2:238118962-238118984 GGTGGATGGAGGAGGGTTAATGG + Intronic
1170228822 20:14022586-14022608 GGTGGGTGGGGGAGGGCTACGGG - Intronic
1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG + Intronic
1174725733 20:52859736-52859758 GGTGGCTGGTGGATTGCAAAGGG - Intergenic
1174884891 20:54322759-54322781 GGTGGATGGTCTACTGCTACGGG + Intergenic
1175934814 20:62509767-62509789 GGTGGAGGGTGGAGGGATAGAGG - Intergenic
1177286067 21:19051895-19051917 GGTGGATGTTGGATTACCATTGG - Intergenic
1178355569 21:31908380-31908402 GGAGGGTGGGGGAGTGCTAGGGG + Intronic
1181643790 22:24219567-24219589 GGTGGAATGTGGAGAGCCATAGG + Intergenic
1183335495 22:37243869-37243891 GGTGGAGGGTGCAGGACTATGGG - Intronic
1183489398 22:38108602-38108624 GGTGGGTAGTGGGGTGCTATTGG + Intronic
950741156 3:15052703-15052725 GGTGGATGGTGGGGTTGTCTCGG - Intronic
951732657 3:25827286-25827308 GGAAGGTGGTGGAGTGCTGTGGG - Intergenic
954229210 3:49203348-49203370 TGGGAATGGTGGAGGGCTATGGG + Intronic
954910639 3:54104419-54104441 TGTGGGTGGTGGAGTGGTTTTGG - Intergenic
954996726 3:54888480-54888502 AGTGGAGGGTGGAGGGCTGTGGG + Intronic
955208384 3:56918054-56918076 GGTGGCTGGTGGAGGGGTAAGGG + Intronic
956066376 3:65401377-65401399 GGTGGATGGTGGGGGGCTGGAGG - Intronic
959845426 3:111027358-111027380 GGTGGAATGTGAAGTGCTACAGG - Intergenic
960304994 3:116050328-116050350 GGGGGATAGTGCAGTGCTCTGGG - Intronic
961969659 3:130947224-130947246 GGTGGATGGACCAGTGCTTTTGG - Intronic
962930807 3:140034297-140034319 GGAGGAGGGAGTAGTGCTATGGG + Intronic
963101387 3:141608952-141608974 GGAGGAATGGGGAGTGCTATTGG + Intronic
964553650 3:157912080-157912102 GGTGGATCTTGGAGTCCTATCGG - Intergenic
967392422 3:188970068-188970090 GTTGGAGGGTGGGGGGCTATGGG - Intronic
968807721 4:2786568-2786590 TGTGGAGGGTGGGGTTCTATCGG - Intergenic
969702299 4:8774222-8774244 GGTGTATCGTGGAGTGCTGGAGG - Intergenic
971048369 4:22831476-22831498 GGTGGATGGAGGGATGCAATGGG - Intergenic
971633874 4:29031590-29031612 GGAGGAAGGAGGAGTGCTAGTGG + Intergenic
980958304 4:139450548-139450570 GGTTGGTGGTGGGGTGCTACTGG + Intergenic
992368337 5:76116073-76116095 GTTGGATGGTGCAGGGTTATAGG - Intronic
992997852 5:82349889-82349911 GGTGGATGGTGGAGAGTTAGGGG + Intronic
994990787 5:106994453-106994475 GTTGGGTGGTGGAGGGCAATGGG - Intergenic
995710226 5:115027647-115027669 GGTGGAGAATGGAGTGCTATCGG - Intergenic
998163720 5:139828430-139828452 GCTGGATGGTGGAGGGCTGGAGG + Intronic
999848126 5:155507639-155507661 GGTGGATGGTGGAATGATGCAGG - Intergenic
1004743376 6:18485580-18485602 GGTGGAGGGAGGAGAGATATTGG - Intergenic
1006597059 6:35201332-35201354 GGTGGAAGATGGAGAGATATGGG - Intergenic
1007351817 6:41279064-41279086 GGTGGAAGGGGGAGGGCTGTAGG - Intronic
1009484875 6:64208052-64208074 TGTGAATAGTGGAGTGCTATGGG + Intronic
1012639312 6:101589430-101589452 GGTGGGTGTTGGAGAGATATTGG - Intronic
1012909393 6:105102186-105102208 GGTTGATGGTGGAGGGATACCGG + Intronic
1014103843 6:117541131-117541153 GGTGGATGATCCAGTGGTATTGG + Intronic
1018062939 6:160104606-160104628 GGTGGATGGTGGAGCAGAATGGG + Intronic
1019004577 6:168785413-168785435 GGTGGAAGGTGGAATTCTCTTGG + Intergenic
1021564578 7:22004280-22004302 GGTGGAAGGTGGGGTGCTGTGGG + Intergenic
1021597309 7:22331018-22331040 GGTGGACAGTGGAGGGCTGTGGG - Intronic
1022478907 7:30730201-30730223 GGTGGATGGGTGAGTGCAGTTGG - Intronic
1023530678 7:41150047-41150069 GGAGGATGGTGGAGTAATCTAGG - Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031248477 7:119349375-119349397 GGTGGAAGGTGGAGCTGTATAGG - Intergenic
1031547499 7:123068347-123068369 AGTGGTTGGTGGGGAGCTATGGG + Intergenic
1033121554 7:138670869-138670891 TGTGGAGGGTGGAGAGCCATTGG - Intronic
1035554748 8:558334-558356 GGTGGAAGGTGGGGGGATATGGG + Intergenic
1035744507 8:1952109-1952131 GGTGGATGGTGGGGTGAGAAGGG - Intronic
1039398497 8:37247632-37247654 GGTGGGTGAAGGAGTGCTCTGGG - Intergenic
1039807943 8:41018444-41018466 GTTGGGGGGTGGGGTGCTATGGG - Intergenic
1041472920 8:58231114-58231136 GATGGAAGCCGGAGTGCTATGGG + Intergenic
1042374921 8:68039420-68039442 GCTGGATATTGGAGTGCTGTGGG + Intronic
1043228961 8:77773924-77773946 GGTGCATGTTGCATTGCTATTGG + Intergenic
1043250653 8:78068999-78069021 GCTGTATGCTGGAGTACTATTGG - Intergenic
1044193395 8:89345948-89345970 GGTGGAAGGAGGAGTTCTTTAGG + Intergenic
1050711525 9:8470852-8470874 GTTGGATGGTTCAGTGCTATGGG - Intronic
1051435932 9:17031796-17031818 GTGGGATGGTGGTTTGCTATGGG - Intergenic
1052371966 9:27675519-27675541 GGTGGAATGGGGAGGGCTATAGG + Intergenic
1052990292 9:34515011-34515033 GCTGTATGGTGGAGAGCTAGAGG + Intronic
1052997567 9:34559390-34559412 GGTGGAGGGTGCAATGCTGTGGG + Intronic
1053483619 9:38435171-38435193 AGTCGGTAGTGGAGTGCTATAGG + Intergenic
1059021655 9:110582392-110582414 GGGGGATGGGGCAGTGCTACTGG + Intergenic
1060151907 9:121294291-121294313 GGTGGGTGGTGGGGTGCTGAAGG + Intronic
1186370940 X:8946836-8946858 GGAGTATGGTGGGGTGCTTTGGG - Intergenic
1186868151 X:13741776-13741798 GGTGCATGGTGGAGAGATCTTGG + Intronic
1186952046 X:14637308-14637330 TGTGGATGGTGGGGAACTATGGG + Intronic
1189469280 X:41301498-41301520 GGTGGAGGGCGGAGTGGTAAGGG + Intergenic
1189735874 X:44069002-44069024 GTTTGATGGTGGAGTGATAAGGG - Intergenic
1193515433 X:82456193-82456215 GTTGGGGGGTGGAGTGCTAGGGG + Intergenic
1198448136 X:136739140-136739162 AGTGGATGGTGGGGTGATTTGGG - Intronic