ID: 1101249279

View in Genome Browser
Species Human (GRCh38)
Location 12:102916366-102916388
Sequence GTGACCTACATATTTACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101249279 Original CRISPR GTGACCTACATATTTACCCA TGG (reversed) Intronic
906015795 1:42578487-42578509 GTAACCTACATATATACATATGG - Intronic
908685092 1:66708798-66708820 ATGACATACATATATAACCAGGG + Intronic
910771966 1:90839898-90839920 ATCACCTACCAATTTACCCAGGG + Intergenic
915805847 1:158848855-158848877 GTGGCATACATATTTTCACATGG - Intronic
916294883 1:163207274-163207296 ATGACCTAAATATTTAACAATGG - Intronic
918964746 1:191328679-191328701 GTTTCCTACAAATTTACACAGGG + Intergenic
920248800 1:204608377-204608399 GTGACTTACATATGCAGCCAAGG - Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
1064977498 10:21133904-21133926 CAGACCTACACATTTACCAAAGG + Intronic
1069411277 10:68155995-68156017 GTGAGCAACATATTTTCTCAAGG + Intronic
1074568137 10:114600225-114600247 GTGACCTTGATATTTCCTCATGG + Intronic
1084600676 11:70143581-70143603 CTGACCTACAGAGTCACCCAGGG - Intronic
1085196835 11:74677749-74677771 CTGACGCACACATTTACCCATGG + Intergenic
1086988991 11:93282113-93282135 ATGACCTAATTATTTACCAATGG + Intergenic
1087414478 11:97836362-97836384 GTGACCAACAAATATACACAAGG - Intergenic
1094157689 12:27354687-27354709 GTGACTTCCATATTTACGCTTGG + Intronic
1100204408 12:92332646-92332668 ATGACCTACACAGTCACCCAGGG - Intergenic
1101249279 12:102916366-102916388 GTGACCTACATATTTACCCATGG - Intronic
1107355769 13:39564637-39564659 TTGACTTACATATTTCCCAAAGG - Intronic
1110634432 13:77749813-77749835 GTGTCCTAAATATTTACACTTGG + Intronic
1112988659 13:105483350-105483372 TTGATCTAGGTATTTACCCATGG - Intronic
1113067181 13:106384473-106384495 GTGACCTACTCAGTGACCCACGG - Intergenic
1113190659 13:107742143-107742165 GTGACCCACACATTTTCCAAAGG - Intronic
1114032231 14:18587570-18587592 GGGACCTAAGTATTTACCTAGGG - Intergenic
1202896720 14_GL000194v1_random:14676-14698 GGGACCTAAGTATTTACCTAGGG + Intergenic
1127741969 15:61917432-61917454 TTGAGCTACATATGTACACATGG - Exonic
1137835021 16:51583662-51583684 GTTACATAAATATTTTCCCAGGG + Intergenic
1140275182 16:73502556-73502578 GTGGCCTTCAGATCTACCCAGGG + Intergenic
1153465044 18:5379430-5379452 GTGAATTACATCTTTGCCCAAGG - Intergenic
1159874682 18:73797278-73797300 ATGACTTACATAGCTACCCATGG - Intergenic
1160255620 18:77246270-77246292 GTGACCCACATTCTTACCCATGG - Intergenic
931290205 2:60866036-60866058 GTCACCTACTCATTTAGCCAGGG + Intergenic
931583258 2:63800591-63800613 GGGACCCACATATTTAACCCTGG - Intronic
935547893 2:104419803-104419825 CTGACCTACTTCTTTATCCAGGG + Intergenic
938295169 2:130173497-130173519 GTGACCAACCTACCTACCCAGGG + Exonic
938491614 2:131764110-131764132 GGGACCTAAGTATTTACCTAGGG - Intronic
938495953 2:131798232-131798254 GGGACCTAAGTATTTACCTAGGG + Intronic
938584332 2:132674348-132674370 GTGACAGAGATATTTGCCCAAGG + Intronic
945937581 2:215918626-215918648 GTGAAATGCATATTCACCCAAGG + Intergenic
946947438 2:224835923-224835945 GTGACCTTTATTTTTAACCAGGG - Intronic
1170033517 20:11966892-11966914 TTGACCTAAATGTTGACCCATGG - Intergenic
1170262776 20:14429856-14429878 GTGACCTTCATGTTTACCAGAGG + Intronic
1172816540 20:37691715-37691737 GTTTCCTACAAATTTAACCATGG + Intergenic
1176616409 21:9030672-9030694 GGGACCTAAGTATTTACCTAGGG + Intergenic
1176708720 21:10132957-10132979 GGGACCTAAGTATTTACCTAGGG - Intergenic
1180456344 22:15514627-15514649 GGGACCTAAGTATTTACCTAGGG - Intergenic
1181077421 22:20390523-20390545 GTGACATACACATGTACACAAGG + Exonic
1182059000 22:27383271-27383293 GCGACCTAAATATCCACCCAAGG + Intergenic
949183316 3:1160774-1160796 ATTACCGACATATTTAGCCAGGG + Intronic
952823284 3:37503429-37503451 ATGACTTACATCTTTAGCCAGGG + Intronic
955865756 3:63382235-63382257 GTGATCTTCATATTCTCCCAGGG + Intronic
956441618 3:69286234-69286256 AAGTCTTACATATTTACCCATGG - Intronic
957506146 3:81123970-81123992 CTGACCTAAACATTTTCCCAAGG - Intergenic
957907909 3:86581447-86581469 GTTACTTACACATTTACCCTAGG + Intergenic
967947192 3:194813401-194813423 GTGGCCTACATTTTTTTCCAAGG - Intergenic
970558688 4:17261153-17261175 GTGACCTAATTATTTCCCAAAGG + Intergenic
975981303 4:80162817-80162839 TTGACTTACATATTTATCCTTGG + Intergenic
976872882 4:89817113-89817135 GAGACTGACATATTTACCCTGGG - Intronic
987437332 5:17911283-17911305 TTTACCTACATCTTTACACACGG - Intergenic
988617435 5:32788927-32788949 GGCACCTACATTTTTAACCAAGG - Exonic
988625154 5:32867112-32867134 GTGACCTAGATAGTCACACAGGG - Intergenic
989317666 5:40101919-40101941 GTAGCCTACAGATTTACCAATGG - Intergenic
991734181 5:69616669-69616691 ATGATCTGCATATTTCCCCAGGG - Intergenic
991810614 5:70471804-70471826 ATGATCTGCATATTTCCCCAGGG - Intergenic
991860086 5:71005479-71005501 ATGATCTGCATATTTCCCCAGGG + Intronic
992385105 5:76277240-76277262 CACTCCTACATATTTACCCAAGG + Intronic
998142489 5:139708093-139708115 TTGATCTAAATGTTTACCCAAGG + Intergenic
1000267706 5:159653556-159653578 GTTACCTACCTATAAACCCAAGG - Intergenic
1008628412 6:53340842-53340864 CTGACTTACATTTTCACCCAAGG + Intronic
1009057563 6:58355363-58355385 GTGACCTACACAGTTGCACAGGG - Intergenic
1009406499 6:63320379-63320401 GTGACCCAGATTTTTACCAATGG + Intergenic
1009931965 6:70187289-70187311 GTGCCCTAAATATATACCCACGG - Intronic
1013094325 6:106930543-106930565 TTGAGCCACATATTTAACCATGG - Intergenic
1013199236 6:107876102-107876124 GTGATGAACATATTTACCCTTGG - Intronic
1020727560 7:11834255-11834277 CTGACCTTTATATTTACCCATGG + Intergenic
1023089613 7:36605428-36605450 GTGACAGACATAATTAACCAGGG + Intronic
1023481539 7:40640209-40640231 GTGAAATAAATATTTACACATGG + Intronic
1025280956 7:57626224-57626246 GAGACCTAGGTATCTACCCAGGG - Intergenic
1027700088 7:81459031-81459053 GGGTCCTACATATCTAACCAAGG + Intergenic
1034348686 7:150402892-150402914 CTGAGCTACACGTTTACCCATGG + Intronic
1035411261 7:158644507-158644529 GTAACCTACATACTGACCCGCGG + Intronic
1038765387 8:30423303-30423325 GTGACCTACAAATATCCACAAGG - Intronic
1039544836 8:38402221-38402243 GTGACATACATACTTTTCCATGG - Intronic
1046221131 8:111216604-111216626 GTGAGCTCCACATTCACCCAAGG + Intergenic
1046699290 8:117382057-117382079 TTGAGCTACTTACTTACCCAAGG + Intergenic
1050590157 9:7152278-7152300 GTGACCTAAATATTTAATAAAGG + Intergenic
1053645696 9:40118455-40118477 GGGACCTAAGTATTTACCTAGGG - Intergenic
1053760011 9:41345054-41345076 GGGACCTAAGTATTTACCTAGGG + Intergenic
1054538875 9:66257517-66257539 GGGACCTAAGTATTTACCTAGGG + Intergenic
1057998156 9:99839367-99839389 GTAGTCTACATATTTAGCCAGGG + Intronic
1059769126 9:117411531-117411553 GTCACCTTCATATTTAACCCTGG - Intronic
1060143838 9:121234177-121234199 GTGAGATACATATTAACCAATGG - Intronic
1202793481 9_KI270719v1_random:101927-101949 GGGACCTAAGTATTTACCTAGGG - Intergenic
1188151135 X:26677265-26677287 ATGACTTACACATTTCCCCAGGG + Intergenic
1188804322 X:34569363-34569385 GTGACCTGCATATATACGCCCGG + Intergenic
1188930619 X:36106291-36106313 GTGACCTTCTTAATTAGCCAAGG + Intronic
1189828851 X:44949758-44949780 TTGAACTACATATTTAACCAGGG + Intronic
1199263886 X:145807524-145807546 ACTACCTACATATTTACTCATGG - Intergenic
1199429077 X:147738421-147738443 GTGACCTGCACAGTTACACAGGG - Intergenic
1201149785 Y:11089397-11089419 GGGACCTAAGTATTTACCTAGGG + Intergenic