ID: 1101249539

View in Genome Browser
Species Human (GRCh38)
Location 12:102918202-102918224
Sequence CTCAGTCTTCTCTAAAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101249539_1101249546 27 Left 1101249539 12:102918202-102918224 CCACACTTTTAGAGAAGACTGAG 0: 1
1: 0
2: 3
3: 18
4: 153
Right 1101249546 12:102918252-102918274 AACAAAGTATAAAAGAATGCTGG 0: 1
1: 0
2: 4
3: 57
4: 646
1101249539_1101249543 -2 Left 1101249539 12:102918202-102918224 CCACACTTTTAGAGAAGACTGAG 0: 1
1: 0
2: 3
3: 18
4: 153
Right 1101249543 12:102918223-102918245 AGGGTGAGGCATTACTGACCAGG 0: 1
1: 0
2: 0
3: 19
4: 102
1101249539_1101249544 1 Left 1101249539 12:102918202-102918224 CCACACTTTTAGAGAAGACTGAG 0: 1
1: 0
2: 3
3: 18
4: 153
Right 1101249544 12:102918226-102918248 GTGAGGCATTACTGACCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101249539 Original CRISPR CTCAGTCTTCTCTAAAAGTG TGG (reversed) Intronic
900971718 1:5995637-5995659 CTCACTCTTCTCTAACTATGGGG - Intronic
901581756 1:10250265-10250287 CTGTGTCGTCTCTAAAATTGAGG - Intronic
902889184 1:19429509-19429531 CTCAGTCTTCTTTAAAACCTGGG + Intronic
909669385 1:78171149-78171171 ATCAGGCTTTTCTAAAAGAGAGG - Intergenic
909736936 1:78972864-78972886 CCCAGTCTGCACCAAAAGTGTGG + Intronic
915148479 1:153809921-153809943 TTCAGTTTTCTTTAACAGTGAGG - Exonic
917681431 1:177372114-177372136 CCCAGTCTTCTCCAAAAATCAGG + Intergenic
919475318 1:198025673-198025695 CTCAGTTTTCTGTCAAAGGGGGG + Intergenic
922254003 1:223875670-223875692 CTCAGTTTTGTCTTTAAGTGGGG + Intergenic
922340009 1:224647661-224647683 CTCTGTCCTCTCTAGAAGTGGGG - Intronic
924022000 1:239793421-239793443 CTCACTCTTTTCTAGAAGTGTGG - Intronic
924526471 1:244855649-244855671 CTAAGTCTTCTGTATAAGTAGGG - Intronic
924633642 1:245764982-245765004 CTCAGTATTCTCTAAGAGTAGGG - Intronic
1063073511 10:2690871-2690893 TTCAGGCTTCTCTAAAAGGTGGG + Intergenic
1065855100 10:29823642-29823664 CTCAGTCTTCTCAGGAAGTCAGG - Intergenic
1069591033 10:69641930-69641952 CTCAGTTTTCTCTATAAATGGGG + Intergenic
1070080698 10:73183837-73183859 CTGAGCCTTCTCCAACAGTGAGG - Intronic
1071957785 10:90778234-90778256 CCCAGTCTTCTCTTAAAGGCCGG - Intronic
1072402903 10:95123568-95123590 CTCTCACTGCTCTAAAAGTGTGG + Intergenic
1073981180 10:109155482-109155504 CTTTGTCTTCCCCAAAAGTGGGG - Intergenic
1080740142 11:35056219-35056241 ATCAGTCTTTTTTAAAAGTTGGG + Intergenic
1081314831 11:41619528-41619550 CTCATTCTTCTATTAAACTGTGG - Intergenic
1083583946 11:63842840-63842862 CTCCCTCTTCTTTAAAAATGTGG + Intronic
1085381851 11:76127100-76127122 CTCTGTCTTCTCTACTAGAGTGG + Intronic
1087195634 11:95301775-95301797 CTCATTCTTCTGTGAATGTGTGG - Intergenic
1089181165 11:116583773-116583795 TTCATTCTTCTCTCTAAGTGGGG + Intergenic
1090941635 11:131392761-131392783 CTCAGCCTGCTCTGAAAGTCTGG + Intronic
1096520067 12:52180047-52180069 CTCTGTCTTCGCCAAAAATGGGG + Intronic
1098291106 12:68957547-68957569 GTCAGTCTTCTGGGAAAGTGTGG - Intronic
1098571510 12:71992616-71992638 CTCTGTCTTTGCCAAAAGTGTGG + Intronic
1099613120 12:84901184-84901206 TTCATTCTTCTTTAAAAGTTTGG + Intronic
1101249539 12:102918202-102918224 CTCAGTCTTCTCTAAAAGTGTGG - Intronic
1101528411 12:105552709-105552731 CTCAGTCCTCTCTGACAGTCTGG - Intergenic
1101869320 12:108550400-108550422 CACAGTATTATTTAAAAGTGGGG + Intronic
1103226575 12:119292905-119292927 GTGAGTTTTCTCTAAAAGAGTGG - Intergenic
1103264317 12:119616118-119616140 CTCACTCTTCTATCAAAGTGTGG + Intronic
1104434004 12:128741313-128741335 CACAGGCTTGTCTACAAGTGGGG + Intergenic
1105245277 13:18644679-18644701 TTCAGGTTTCTCTTAAAGTGAGG - Intergenic
1105809261 13:23979959-23979981 CTCTACCTTCTCCAAAAGTGCGG - Intronic
1106527792 13:30558399-30558421 CTCATTCTTAGCCAAAAGTGTGG + Intronic
1108037029 13:46301490-46301512 TTAAGTCTTCTTTAAAAGTCTGG - Intergenic
1108932631 13:55846930-55846952 CTCAGTCTCATCTAAAAGTCTGG + Intergenic
1109226491 13:59702271-59702293 CTCAGTCTTCATTATAAGTTAGG - Intronic
1111846759 13:93519360-93519382 CACATTCTTCCGTAAAAGTGGGG + Intronic
1112528013 13:100171400-100171422 GACAGTCTTCTCTGAGAGTGTGG + Intronic
1112750921 13:102582601-102582623 CTCAGTCTTCCCTAACCCTGTGG + Intergenic
1118228554 14:63926698-63926720 CTCAGTCTTATTTGAAAATGGGG - Intronic
1119962615 14:78877193-78877215 GTTAATCTTCTCTAAAATTGAGG + Intronic
1120356497 14:83441204-83441226 CTCAGGCTTCTCTGTAAGTTTGG - Intergenic
1121835687 14:97090069-97090091 CTCAGACTTCTCTAAAAGGAGGG + Intergenic
1122450169 14:101799393-101799415 CGCTGGCTTCTCTAAACGTGAGG + Intronic
1126822104 15:52514549-52514571 TTCAGTCTTCACTTTAAGTGAGG - Intronic
1126963924 15:54029900-54029922 CTCAGTCTTCTCTGATATTGAGG + Intronic
1127027514 15:54823752-54823774 ATCAGTCAGCTATAAAAGTGTGG + Intergenic
1127282221 15:57502094-57502116 CTAAGTCTTCTCTCAAAGCATGG - Intronic
1130717857 15:86353764-86353786 CCCATTCTTCCCTAAAAGTCTGG - Intronic
1138780662 16:59781096-59781118 ATCAGTCTACTCTAAATGGGAGG + Intergenic
1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG + Intergenic
1142887807 17:2924039-2924061 CTAAGAGTTCTCTAACAGTGAGG + Intronic
1146714632 17:35074814-35074836 CTTATTCTTGTCTAAAAGTATGG - Intronic
1151554868 17:74841700-74841722 CTCAGTCTCCTTGAAAAGGGAGG - Intergenic
1153875964 18:9371096-9371118 ATCTGTCATTTCTAAAAGTGAGG - Intronic
1153895630 18:9556492-9556514 CTCAGTGTTTTTTAAAAGGGAGG + Intronic
1154443671 18:14415268-14415290 TTCAGGTTTCTCTTAAAGTGAGG + Intergenic
1156741063 18:40328647-40328669 CTCTGTCTTCTAGAACAGTGAGG - Intergenic
1159021733 18:63148862-63148884 CTTGGTCATCTCTAAAAGAGGGG - Intronic
1160373142 18:78390884-78390906 CACCGTGTTCTCTGAAAGTGTGG - Intergenic
1164536559 19:29090191-29090213 CTGAGTGTTCTTTTAAAGTGTGG + Intergenic
1164767126 19:30780761-30780783 CTTAGCCTTCTCTGAAACTGAGG - Intergenic
928802707 2:35113618-35113640 ATCAGTCTTCTTTAAATGTTTGG - Intergenic
930307482 2:49693798-49693820 TTCAGTCTTATCTAAATGTGGGG - Intergenic
931158917 2:59666653-59666675 GTCACTCTTCTCTAATACTGGGG - Intergenic
931629122 2:64283661-64283683 CTCAGGCATCTCAAAAAGTCTGG - Intergenic
934744590 2:96750840-96750862 CTCCCTCTGCTCTAAGAGTGAGG - Intergenic
935225511 2:101048682-101048704 CTCTGTCTTTTCTCAATGTGTGG - Intronic
936258296 2:110935561-110935583 CTGCGTCTTCTCTAACAGGGTGG - Intronic
936710398 2:115124112-115124134 CTTATTCTTATGTAAAAGTGGGG + Intronic
937008500 2:118540314-118540336 CTCAATCTACTGTACAAGTGGGG + Intergenic
937950169 2:127379401-127379423 CTCACTCCTCTGTAAAATTGGGG - Intronic
939100469 2:137889803-137889825 TTCAGGTTTCTCTTAAAGTGAGG - Intergenic
942626499 2:177906545-177906567 CTCTATCTTCTTTAAAAATGAGG - Intronic
942965039 2:181882036-181882058 CTGAGTCTTCTCCAGAAATGTGG + Intergenic
943277794 2:185890444-185890466 TTCAGTCTTCACACAAAGTGAGG + Intergenic
943782258 2:191837511-191837533 CTCACTCTTCGCTGGAAGTGAGG - Intronic
943962034 2:194277105-194277127 CTGACTCTTCTCTAAATGTGTGG - Intergenic
945808935 2:214524457-214524479 CTAAGTTTTCTCTAAAAATGAGG + Intronic
947348656 2:229220249-229220271 CTCAGTTTTCTCTGTAAATGAGG - Intronic
947972665 2:234337120-234337142 CACAGTCTTCTCCAAGTGTGTGG + Intergenic
1170061933 20:12268401-12268423 TTTTGTCTTCTCTAAAAGTAAGG - Intergenic
1170371245 20:15650841-15650863 TTCAGTCTTCTGAAAAGGTGTGG - Intronic
1171022414 20:21598008-21598030 CTCAGTCTTCTAACACAGTGAGG + Intergenic
1174568086 20:51481348-51481370 TTCAGGCTTCTCCAAAGGTGAGG + Intronic
1176452417 21:6875970-6875992 TTCAGGTTTCTCTTAAAGTGAGG - Intergenic
1176830590 21:13741019-13741041 TTCAGGTTTCTCTTAAAGTGAGG - Intergenic
1178190736 21:30277172-30277194 CTCTGTTGTCTATAAAAGTGAGG + Intergenic
1179299512 21:40093984-40094006 CTCACTCTCCTCTAAAAGGCTGG + Intronic
1179516650 21:41913088-41913110 GTTAGTCTTGTCTAAAAGTGGGG - Intronic
1181813266 22:25418368-25418390 CTCTGTCTTCTCAAAAAGCCGGG + Intergenic
1181844631 22:25697297-25697319 CTCTGTCTGCTCCAACAGTGTGG + Intronic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
1184957810 22:47903470-47903492 CTCAATTTTCACTAAAAGTATGG + Intergenic
1185005592 22:48274913-48274935 CTGAGTCTTCTCTAAATGAAGGG + Intergenic
956156455 3:66303427-66303449 CTTAGTCTTGGCTAAAAGTGAGG + Intronic
959344405 3:105174594-105174616 TTTATTCTTCTCTCAAAGTGAGG + Intergenic
962187350 3:133273844-133273866 CTAAGTCTTCTCTCACAGAGTGG - Intronic
965352335 3:167629045-167629067 CTCAGTCTTTTCTCAAACTCTGG - Intronic
967830177 3:193911989-193912011 CTTAGTCTTCACTGTAAGTGGGG - Intergenic
969046661 4:4341345-4341367 CTCAGCTTTTTCTTAAAGTGAGG + Intergenic
970366324 4:15362083-15362105 CCCAGTTTTCTCTAAAATGGGGG + Intronic
973293012 4:48488923-48488945 CTCAGACTTCTCTCTAAATGTGG + Exonic
973310659 4:48706136-48706158 TTCAGTCTACACTAAAAGGGAGG - Intronic
975421355 4:74167774-74167796 CACAGTGTTCTTTAACAGTGAGG + Intronic
976930824 4:90564819-90564841 ATCAGTTTGCTCTAAATGTGTGG + Intronic
976954585 4:90880123-90880145 CTCAATGCTCTCTGAAAGTGTGG + Intronic
977596658 4:98889608-98889630 TTCAGTTTTCTATAAATGTGTGG - Intronic
979199686 4:117962151-117962173 CTCAGAATTCTATAAAATTGTGG - Intergenic
979767443 4:124479284-124479306 CTCAGTCTTCACTGAACATGAGG - Intergenic
981953568 4:150442624-150442646 TTCATTCTTCCCTAAAAGTAGGG + Intronic
982356175 4:154471800-154471822 CCCAATCTTCACAAAAAGTGTGG + Intronic
985245305 4:187974634-187974656 CCCAGTATTCTCTAAGAGTCAGG + Intergenic
987248518 5:16075564-16075586 CTCAGTCTTTGCTGAAAGAGAGG + Intronic
993028603 5:82675929-82675951 CTCTCTCTTTTCTAAAATTGTGG - Intergenic
993663684 5:90669092-90669114 CACAGTCTCCTCTGAAAATGGGG - Intronic
994615357 5:102098056-102098078 CTCGGTTTTCTCTGAAATTGTGG + Intergenic
995577009 5:113547706-113547728 ATCAGTGTTCTTTTAAAGTGAGG - Intronic
996182224 5:120432788-120432810 CTCATTCTTCTCTCAAAGTGGGG - Intergenic
1007403101 6:41616076-41616098 CTCATTCTGCTCTAAAAATAAGG - Intergenic
1010495675 6:76532096-76532118 CTCTTTCTTCTCTAAAAGTGTGG + Intergenic
1011803305 6:91043082-91043104 CTCAGTCTTCTCTAAAAAGGGGG - Intergenic
1013969815 6:116003210-116003232 CTAAGTCATCTCTAAATATGAGG - Intronic
1014456210 6:121637362-121637384 ATCAGTCTACTGTTAAAGTGAGG - Intergenic
1014869268 6:126571606-126571628 CACAGTCATTTCTTAAAGTGGGG - Intergenic
1016969060 6:149745827-149745849 CTCAGTTTTCTGTAAACGAGGGG + Intronic
1017916970 6:158838533-158838555 CGCAGCTTTCTCTCAAAGTGGGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1023570366 7:41565530-41565552 CTCAGGCTTCTGTAAAGGAGAGG - Intergenic
1023745478 7:43318981-43319003 CTTAGTCTGCACTGAAAGTGTGG + Intronic
1024035058 7:45500903-45500925 CATAGTCTCCTGTAAAAGTGAGG + Intergenic
1024413062 7:49069475-49069497 CTCAGCCTGCTCTATATGTGAGG + Intergenic
1026186734 7:68087747-68087769 ACCAGTGTTATCTAAAAGTGAGG + Intergenic
1036008444 8:4693457-4693479 CTCATTCTTCTCTAACTATGTGG + Intronic
1036913570 8:12782423-12782445 CTCATTCTTCTTTAAATGTTTGG + Intergenic
1038185183 8:25266812-25266834 CTATGTCTTCTCTAGAATTGTGG - Intronic
1039261408 8:35775704-35775726 CTCTTTCTTCTCTGAAAGGGAGG + Intronic
1040751799 8:50718532-50718554 CTTATTCTTCTCTAAGAATGAGG + Intronic
1040948340 8:52909031-52909053 CTCAGACTTCTCCATAGGTGGGG + Intergenic
1043804730 8:84657689-84657711 GGAAGTCTTCTCTAAAACTGGGG + Intronic
1044428806 8:92084786-92084808 CTCAGCCTTCTCTAAAACCCTGG - Intronic
1046139853 8:110077402-110077424 CTCAGTCTTCTGTAAATTTGGGG + Intergenic
1046777812 8:118182244-118182266 CTCAGTCTTCTCTGATGATGGGG - Intergenic
1047019506 8:120759829-120759851 TTCACTCATCTCTAAATGTGAGG + Intronic
1047725521 8:127680804-127680826 CACAGTCTTCTCTAAATCTGGGG + Intergenic
1048610360 8:136015615-136015637 CTCAGTTTTCTCAGAAAATGAGG + Intergenic
1048805839 8:138240552-138240574 CTCAGTGCTCAATAAAAGTGTGG - Intronic
1048826792 8:138435659-138435681 CTCAATATTCTCTAAAATTTAGG + Intronic
1049433710 8:142576741-142576763 CACAGTCTACTCTCAAAGGGTGG + Intergenic
1050172235 9:2833422-2833444 CACAGTCTTTTCTACAAATGAGG + Exonic
1051884298 9:21873984-21874006 CTGAGTCATCTATAAAACTGAGG - Intronic
1055264655 9:74481142-74481164 CTGAGTATTCTATACAAGTGAGG - Intergenic
1057608586 9:96520216-96520238 CGCTTTCTTCTTTAAAAGTGTGG + Intronic
1060378991 9:123147559-123147581 CTCAGCCTTCTCAAATAGTAGGG - Intronic
1203516764 Un_GL000213v1:8545-8567 TTCAGGTTTCTCTTAAAGTGAGG + Intergenic
1187618048 X:21020104-21020126 CTCTCTCCTCTCTAGAAGTGTGG - Intergenic
1189097250 X:38153710-38153732 TTCAGGCTTCTGCAAAAGTGGGG - Intronic
1191964147 X:66738437-66738459 TTCATTCTTCTTTAAAAGTTTGG + Intergenic
1193332746 X:80253863-80253885 CTCATTATTCCCTACAAGTGAGG - Intergenic
1193416012 X:81224965-81224987 CTCAGTCTTTTCTAAAAAAAAGG + Intronic
1193515645 X:82459199-82459221 CACAGTCTTCTCTTAATCTGAGG - Intergenic
1193834075 X:86321409-86321431 CTCAGTCTTCCTAAAAAGTCAGG + Intronic
1193956203 X:87866510-87866532 CTGAATCTTCACTAAAATTGTGG + Intergenic
1197446710 X:126559289-126559311 TTAAGTCTCCTCTAAAAGTTTGG - Intergenic
1197689607 X:129484157-129484179 CTAATTTTTCTCTAAAAATGTGG + Intronic
1197928567 X:131672414-131672436 CTCTGTTTTCTCAAAAAGTCAGG + Intergenic
1199479395 X:148281499-148281521 ATCAGTCATCTCTAAAGGAGTGG - Intergenic