ID: 1101254260

View in Genome Browser
Species Human (GRCh38)
Location 12:102962163-102962185
Sequence AGCCGGGGCTTGTGCGGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101254260 Original CRISPR AGCCGGGGCTTGTGCGGCGA AGG Intergenic
900003460 1:29017-29039 AGCCAAGGCTTGTGGGGCGCAGG - Intergenic
900023180 1:199533-199555 AGCCAAGGCTTGTGGGGCGCAGG - Intergenic
900419729 1:2550703-2550725 AGCCGGGTCTTGGGCGCAGAGGG + Intergenic
900863686 1:5251887-5251909 AGGCGGAGCTTGTGCAGTGAGGG + Intergenic
902292314 1:15443358-15443380 AGCCTGAGCTTGTGGGGCCAGGG + Intronic
907274873 1:53311428-53311450 GGCCAGGGCTTGTGTGGGGAGGG - Intronic
912716939 1:111989781-111989803 AGCCGGGGCTGGAGCGGCGGAGG - Intergenic
913113918 1:115679619-115679641 AGCTGGGGCCTGTGAGGGGATGG - Intronic
913532640 1:119743495-119743517 AGCTGGGGCTTGGGCTGCTAGGG + Intronic
922818803 1:228470378-228470400 AGCCGGGGAGTGTGCGGGGAGGG + Intergenic
923782917 1:237042146-237042168 AGCCGGGGTTAGTGCAGCGGTGG - Intergenic
1064164949 10:12977921-12977943 GGCCCGGGCTTGTGCGTGGATGG + Intronic
1064384523 10:14878774-14878796 GGCCGGGGCTTGTTGGGGGACGG - Intergenic
1067214655 10:44292692-44292714 AGCCGGGGTCTGTGCGCCGCGGG + Intergenic
1069898908 10:71695874-71695896 AGCTGGGGCTTGTGCAGTGTAGG - Intronic
1077360416 11:2138179-2138201 GGCCGGGGCTGGGGCGGCGCGGG - Intronic
1081611317 11:44565192-44565214 AGCCCAGGCTGGTGCGGGGAGGG + Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084175172 11:67419104-67419126 CGCCGGGGCTGCTGCGGGGAGGG + Exonic
1084494338 11:69495397-69495419 AGCAGGGGCTGGTGAGGTGAGGG - Intergenic
1084676588 11:70639077-70639099 AGCCTGGGCTGGTGCTGGGAAGG + Intronic
1085047769 11:73363345-73363367 AGCCGTGGCTGGAGCGGCGAAGG - Exonic
1086888336 11:92227092-92227114 ACCCGGGGCTTGAGCGGCTGGGG + Intergenic
1087105053 11:94400332-94400354 AGCCAGAGCTTCTGCGGCGGTGG - Intronic
1091376879 12:31071-31093 AGCCAAGGCTTGTGGGGCGCAGG - Intergenic
1095725196 12:45444840-45444862 ACCTGGGGCTTGTGCAGCCAAGG + Intergenic
1098426076 12:70366598-70366620 AGCAGGGGAGTGGGCGGCGAGGG - Exonic
1101254260 12:102962163-102962185 AGCCGGGGCTTGTGCGGCGAAGG + Intergenic
1102490581 12:113287667-113287689 AGGCGGGGCAGGTGCGGGGAGGG + Intronic
1114524516 14:23359591-23359613 AGCCGGGGCCTGTGTGGGGGTGG + Exonic
1115906678 14:38209438-38209460 AGCCCGGGCAGCTGCGGCGAAGG + Exonic
1119263611 14:73252068-73252090 AGCCGGGGCTGGGGCGGCGCAGG - Exonic
1132450041 15:101961923-101961945 AGCCAAGGCTTGTGGGGCGCAGG + Intergenic
1132500441 16:282515-282537 CGCCGGGGCCTGCGCGGTGAGGG + Exonic
1132958363 16:2608641-2608663 AGCGGGGGCCTGTGCTGCTAGGG - Intergenic
1132970975 16:2688737-2688759 AGCGGGGGCCTGTGCTGCTAGGG - Intronic
1147364908 17:39953134-39953156 AGGCTGGGCTGGTGCGGTGAGGG + Intergenic
1147557652 17:41489605-41489627 AGCGGGGGCTGGTTCTGCGAGGG - Exonic
1148495045 17:48048514-48048536 GGCCGAGGCTTATGGGGCGACGG + Intronic
1160635213 19:70625-70647 AGCCAAGGCTTGTGGGGCGCAGG - Intergenic
1160904049 19:1444172-1444194 AGCAGGGGCGTGTGCAGGGAGGG - Intergenic
1161015698 19:1981808-1981830 AGCCGGGGCTAGTGCTGCCAAGG - Intergenic
1162752725 19:12838688-12838710 AGCGGCGGCTTTTGCGGGGAGGG - Intronic
1166869490 19:45862981-45863003 AGCAGGGGCTCGGGCGGGGAGGG - Intronic
1167237126 19:48321841-48321863 AGCCGGGAGTTGCGCGGAGAAGG + Intronic
929575896 2:43051472-43051494 AGCTGGGGCTTGTGAGGGGTAGG - Intergenic
934521889 2:95025149-95025171 AGCCGGCGCTGGTTCGGCGCTGG - Intergenic
936566267 2:113584418-113584440 AGCCAAGGCTTGTGGGGCGCAGG + Intergenic
941905611 2:170714774-170714796 GGCGGGTGCGTGTGCGGCGAGGG + Intergenic
948387778 2:237592347-237592369 AGCCAGGCCTTGTGTGGAGAAGG + Intronic
1172149403 20:32779764-32779786 AGGCGGGGCTTGTGCTGCCATGG + Intronic
1173384197 20:42573243-42573265 AGGCTGGGCTTGTGCAGCCAGGG - Intronic
1175715414 20:61252113-61252135 AGGCTGGGCTGGTGCGGCGCGGG + Intergenic
1176109389 20:63404554-63404576 GGCCGGGGCTGGTGCTGCGTTGG + Intergenic
954380397 3:50216034-50216056 AGAAGGGGCTTGTGGGGCTAGGG + Intronic
954615740 3:51967865-51967887 AGCCGGGGCTGGCGGGGCCAAGG - Intronic
956084699 3:65597293-65597315 AGCCCGGGCTTTTGGAGCGAGGG - Intronic
968506348 4:973045-973067 GGCCGGGGCCTGTGCGCCGTGGG - Intronic
973634838 4:52852280-52852302 AGCCGGGGCTGGAGTGGGGAGGG - Intergenic
981615375 4:146639039-146639061 AGCCGGGGCTGGAGCTGGGAAGG - Exonic
981775985 4:148368219-148368241 AGCTGGGGTTTGTGGGGCTATGG - Intronic
985769163 5:1798228-1798250 AGCCTTGGCTTGTACAGCGACGG + Intergenic
989637991 5:43556779-43556801 AGCCGGGGCCTGGGCCGCGGAGG - Exonic
1006751257 6:36379133-36379155 AGCCAGGGCTTCCGCGGCTAGGG + Intronic
1014205525 6:118651617-118651639 AGCCGGGGCTGGGGCCGCGAGGG + Intronic
1016614436 6:146029568-146029590 TGCCGGGGCTTCTGGGGAGAAGG - Exonic
1018215070 6:161518617-161518639 AGGCTGGGCTTGTGCTGCTAGGG - Intronic
1023921063 7:44630287-44630309 AGCCGCTGCATGTGCGGTGAAGG + Intronic
1025089595 7:56051501-56051523 AGGCGGGGCTTGTGCTCCGCGGG - Exonic
1029529265 7:101114590-101114612 AGCCGGGGCTGTTGGGGTGAGGG - Intergenic
1029642015 7:101826852-101826874 AGTGGGGGCCTGTGTGGCGATGG - Intronic
1034978261 7:155460246-155460268 GGCCGGGCTTTGTGCGGCGCGGG + Intronic
1039886333 8:41656163-41656185 AGCCAGGGCTTGTGCCAAGAAGG + Intronic
1043173919 8:77000394-77000416 AGCCGGGGCTTGGGAGGGCAGGG + Intronic
1049886266 9:29131-29153 AGCCAAGGCTTGTGGGGCGCAGG - Intergenic
1058235417 9:102484991-102485013 GGCCGGGGCTGGTGTGGCAATGG - Intergenic
1060090156 9:120735500-120735522 TGCCAGGGCTTGTGGGGCAAGGG + Intergenic
1060821753 9:126665302-126665324 AGCCAGGGCTGGGGCGGCGGGGG + Intronic
1060918434 9:127404668-127404690 AGTCAGGGCTTCTGCGGCCAAGG + Intronic
1061015863 9:127980619-127980641 TGCGGGGGCGTGAGCGGCGAGGG - Intergenic
1200089556 X:153627951-153627973 GGCCGGGGCTGGGGCAGCGAGGG + Intergenic
1200829128 Y:7673407-7673429 AGCCGGGGCTGGCGGGGGGAGGG - Intergenic