ID: 1101254395

View in Genome Browser
Species Human (GRCh38)
Location 12:102963507-102963529
Sequence CAGGGAGGTTACCATGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 3, 3: 15, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101254395_1101254402 22 Left 1101254395 12:102963507-102963529 CCTACTACATGGTAACCTCCCTG 0: 1
1: 1
2: 3
3: 15
4: 203
Right 1101254402 12:102963552-102963574 TGTCTTGTCTTCCCTGCCCCTGG 0: 1
1: 0
2: 3
3: 40
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101254395 Original CRISPR CAGGGAGGTTACCATGTAGT AGG (reversed) Intergenic
901358137 1:8670434-8670456 CAGAGAGATTACAATCTAGTGGG + Intronic
902210468 1:14901052-14901074 CAGGGAGCTTACTGTGTGGTAGG + Intronic
902305055 1:15530610-15530632 CCAGGAGATTAGCATGTAGTAGG - Intronic
905537511 1:38734639-38734661 CAGGAAGATTACCATGAGGTAGG + Intergenic
906127999 1:43439366-43439388 CAGGGAGGCCACCCTGTGGTGGG - Exonic
906775699 1:48527681-48527703 CTGGGAGGATATCATGAAGTTGG + Intergenic
906931056 1:50169928-50169950 CAGGGAGCTTATAATGTAGAAGG - Intronic
907880192 1:58542392-58542414 CATGGAGGTTATAATCTAGTTGG + Intronic
908040216 1:60104697-60104719 CAGGGAGGCTAAAATGTAGGGGG - Intergenic
908677437 1:66621033-66621055 CATGGAGCTCACCATCTAGTGGG + Intronic
909606456 1:77513358-77513380 CAGAGAGGTCACAATCTAGTGGG - Intronic
911520058 1:98918960-98918982 CAGGGAGCTTACATTCTAGTGGG + Intronic
914943435 1:152042831-152042853 CAGTGAGTTTAACATGTTGTAGG + Intronic
915599935 1:156915740-156915762 CAGGGAGCTTACAGTCTAGTGGG - Exonic
916755506 1:167766170-167766192 TTGGGAGCTTACTATGTAGTGGG + Intronic
917211705 1:172638344-172638366 CAGGGGGCTTACATTGTAGTTGG + Intergenic
917300784 1:173571650-173571672 CATGGAGTTTACAATGTAATTGG - Intronic
919496810 1:198282871-198282893 CAGGGAGCTTACCTTATGGTGGG + Intronic
919626789 1:199918965-199918987 CATGGAGCTTACAATGTAGCAGG + Intergenic
921972439 1:221164957-221164979 CAAGGACGTTACCATCTAGTTGG - Intergenic
923177002 1:231476286-231476308 CAGGGTGGTTACTATGTTCTTGG + Intergenic
1062940013 10:1414041-1414063 CAGGGAGGCTTCCAGGGAGTGGG - Intronic
1065007742 10:21395321-21395343 CAGGGAGGGGACCAGGGAGTGGG - Intergenic
1067009779 10:42700253-42700275 CAGGGAGCTTACATTCTAGTGGG + Intergenic
1067838438 10:49656384-49656406 TAGGGAGGTTACCATGTAGTTGG + Intronic
1068799889 10:61128275-61128297 CAAGGAGCTTACAATGTAATTGG + Intergenic
1069954683 10:72042734-72042756 CAGGGGGGCTGCCATGAAGTTGG + Intergenic
1070673812 10:78398190-78398212 CTGGGAGGACACGATGTAGTTGG - Intergenic
1070784866 10:79157006-79157028 CAGGGAGGGTACCTTGGAGGTGG + Intronic
1071063440 10:81601734-81601756 CAGAGAGTTTACCTTCTAGTGGG + Intergenic
1072434111 10:95399975-95399997 CAGGGAGCTTACAGTCTAGTGGG + Intronic
1072681194 10:97508053-97508075 CAGGGTGTTTGCCATGTACTAGG + Intronic
1072732541 10:97856588-97856610 TTGGGAGGATACCCTGTAGTGGG + Intronic
1073727009 10:106244433-106244455 CAGGGAATTTACCATGTAGCAGG - Intergenic
1076904637 10:133355894-133355916 CAGGGAGGGCACCAGGAAGTGGG + Intronic
1079079599 11:17405102-17405124 CAGGGAGTTTACCTTGTAGCTGG - Intronic
1081198140 11:40186216-40186238 CAGGGAGTCTACAATGTGGTAGG + Intronic
1082615100 11:55349678-55349700 GAGGTAGGTTACCATGTTCTTGG - Intergenic
1083759188 11:64806519-64806541 CAGGGAGGAGACCAGGTAGAAGG - Intronic
1084724800 11:70934482-70934504 CAAGGAGCTTACCCTGTAGCAGG - Intronic
1085068145 11:73516924-73516946 CATGGAGTTTACTATCTAGTGGG + Intronic
1085600331 11:77849982-77850004 TAGGGAGTTTACCACTTAGTGGG - Intronic
1087222069 11:95557287-95557309 CAGGGAGGGTGCAATCTAGTTGG + Intergenic
1088234193 11:107704908-107704930 CATGGAGCATACCATTTAGTGGG - Intergenic
1088651160 11:111958879-111958901 CAGGGAGGAGACCCTGGAGTGGG - Intronic
1088843236 11:113644154-113644176 CAGGGGTGTTGCCAGGTAGTTGG - Intergenic
1090426654 11:126611721-126611743 CTGGGAGGCTACCATGTTCTTGG - Intronic
1091016571 11:132056472-132056494 CAGGGAGCTTACATTTTAGTGGG - Intronic
1092064700 12:5580092-5580114 CAGGAAAGTTACAATGTAGTAGG + Intronic
1092207943 12:6627699-6627721 CTAGGAGCTTACCATCTAGTTGG - Intronic
1093543408 12:20316064-20316086 CATGGAGCTTACAGTGTAGTAGG + Intergenic
1093893711 12:24553570-24553592 CAGGGAGCTTACCTTCTAATTGG + Intergenic
1095603224 12:44037835-44037857 CAGAGAGGAGACCCTGTAGTGGG - Intronic
1096357550 12:50954247-50954269 CTGGGGGCTTACCATGTATTAGG - Intronic
1096431792 12:51550473-51550495 CAAGGAGCTTCCCATCTAGTAGG + Intergenic
1097553856 12:61113083-61113105 CAAGGAGGTGACCATGTCCTTGG + Intergenic
1097975351 12:65680059-65680081 CAGGGAGGTTACTTTCTAGTGGG + Intergenic
1099003006 12:77203055-77203077 CAAGGAGGTTAACATCTAATTGG - Intergenic
1100140972 12:91618567-91618589 CATGGGGATTGCCATGTAGTTGG - Intergenic
1100970912 12:100069261-100069283 CTGGGTGGATACCAAGTAGTGGG - Intronic
1101254395 12:102963507-102963529 CAGGGAGGTTACCATGTAGTAGG - Intergenic
1101631325 12:106497936-106497958 CATGGAGGTTACATTCTAGTTGG - Intronic
1101645267 12:106625686-106625708 CATGGAGTCTAGCATGTAGTAGG - Intronic
1102410679 12:112715639-112715661 CTGTGAGCTCACCATGTAGTTGG - Intronic
1104624496 12:130340063-130340085 AAAACAGGTTACCATGTAGTAGG + Intronic
1104909868 12:132235556-132235578 CAGGGTGGTCAGCATGGAGTTGG + Intronic
1106075605 13:26458405-26458427 CAAGGAGGTTACCATCCAGAGGG - Intergenic
1107521313 13:41185040-41185062 CAGGAAGCTTACCAGTTAGTAGG + Intergenic
1108109215 13:47049810-47049832 CAGGGATGTTGTCATGTGGTTGG - Intergenic
1110021963 13:70485751-70485773 AGGGGATGTTACCATGAAGTTGG + Intergenic
1110716122 13:78706422-78706444 GAGGGAGTTTACAATCTAGTTGG - Intergenic
1112646381 13:101337654-101337676 GAGGGAGGTCACCATGTTGCAGG + Intronic
1113576010 13:111395894-111395916 CAGGGAACTTTCCATCTAGTCGG - Intergenic
1115259811 14:31440493-31440515 CAAGGAATTTACCATCTAGTAGG - Intronic
1116994370 14:51307015-51307037 CAGGGAGCTTACAATGCAGAGGG - Intergenic
1118367799 14:65110422-65110444 CAAGGAGCCTAGCATGTAGTAGG + Intergenic
1123207687 14:106728753-106728775 CAGAGAGCTTACTATATAGTAGG - Intergenic
1127492501 15:59478450-59478472 CAGTGATGTTAACATGTAGTCGG + Intronic
1128629942 15:69254547-69254569 CAGGGTAGTAACAATGTAGTTGG + Intronic
1129993855 15:79987920-79987942 CAGGGAGCTTACGTTCTAGTGGG - Intergenic
1133890645 16:9875944-9875966 CAGGGAACTTATAATGTAGTGGG - Intronic
1134010659 16:10849888-10849910 CATGCAGGATACCATGTAGAGGG - Intergenic
1134301263 16:12993643-12993665 CATGGAGTTTACCCTGTAGCAGG + Intronic
1135150705 16:20002855-20002877 CAGGGAGGCTAACAGTTAGTTGG + Intergenic
1137334277 16:47533021-47533043 CAGGGAGGAGACCATGGAGTGGG + Intronic
1137600119 16:49750670-49750692 CAGGGAGTTTACCCTCTAGTGGG + Intronic
1139770485 16:69271427-69271449 CAAGGAGGTTATAATTTAGTGGG - Intronic
1141376562 16:83536225-83536247 CATAGAGCTTACAATGTAGTTGG + Intronic
1144268663 17:13596326-13596348 GAGGAAAGTTACCAAGTAGTTGG - Intronic
1146785402 17:35716099-35716121 CAGAGAGCTTACCATTTAGAAGG + Intronic
1149585803 17:57785581-57785603 CATGGAGCTTACAATCTAGTTGG - Intergenic
1150722850 17:67628285-67628307 TTGAGAGGTTACCATCTAGTAGG - Intronic
1156299395 18:35822682-35822704 CAGGGAGCTTAATATGGAGTGGG - Intergenic
1157343719 18:46804208-46804230 CATGGAGCTTACAATCTAGTAGG + Intergenic
1157528535 18:48403633-48403655 CAGGGAGCTTACACTCTAGTGGG + Intronic
1157621990 18:49021917-49021939 CAGGGAGGTTACCTAGCAGACGG + Intergenic
1157684015 18:49628585-49628607 CTGGGAGCTTACCATCTTGTTGG + Intergenic
1159361605 18:67412014-67412036 TAAGGAGGTTACGATGAAGTTGG - Intergenic
1168387631 19:55978813-55978835 TAGGGAGGCTACTAGGTAGTAGG + Intronic
927099776 2:19779202-19779224 CAGGGAGCTTACAGTCTAGTGGG + Intergenic
927613533 2:24566264-24566286 CAGAGAGGAGACCATGGAGTTGG + Intronic
927875084 2:26649920-26649942 CAGGGAGGTTAGAGTCTAGTAGG + Intergenic
927965606 2:27265774-27265796 CAGGGAGCTTGCCCTGTAGCAGG - Intronic
928922354 2:36539030-36539052 CACGGAGCTTACGTTGTAGTAGG + Intronic
929868055 2:45735046-45735068 GAGGGAGATTAGCATGTAGGAGG - Intronic
931455557 2:62407364-62407386 CAAGGAGGTTAAAATCTAGTGGG + Intergenic
931500119 2:62855967-62855989 CAGGGAGGAGACCCTGGAGTGGG - Intronic
933839333 2:86273861-86273883 CAGGGAGCTTACAATGTATTAGG - Intronic
934019659 2:87933469-87933491 CAGGGAGCTTACCATCTCATTGG + Intergenic
937062136 2:118988590-118988612 CAGGGAGGTCACTATGTCTTGGG - Intronic
937272148 2:120659899-120659921 CAGGGAGGTCACCATGCAAAGGG + Intergenic
937757227 2:125554892-125554914 AAGGGTGATTACCATGCAGTGGG - Intergenic
938066252 2:128283504-128283526 CAGGGAGGTGTCCATGGAGGAGG + Intronic
941647306 2:168054974-168054996 CAGAGAGCTTACCATGTAGGCGG - Intronic
942185345 2:173420189-173420211 CCAGGAGTTTATCATGTAGTGGG + Intergenic
942186269 2:173427606-173427628 CATGGAGGTTACAATCTAGTGGG + Intergenic
943213521 2:185000354-185000376 CAAGGAAGTAACCATGTACTTGG - Intergenic
946060988 2:216941432-216941454 CAAGGAGTTTACCATCTACTGGG - Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946581439 2:221132454-221132476 CAGAGAGCTTACCTTTTAGTGGG - Intergenic
1173716869 20:45215605-45215627 CCGGGTGGTTACCCAGTAGTGGG - Intergenic
1175557517 20:59879112-59879134 CAGGGAGCTTACAGTCTAGTGGG - Intronic
1180928401 22:19572163-19572185 CAAGGAGGTTACCAGGTACACGG + Intergenic
1181413279 22:22739969-22739991 GAGGGAGGATTCCATGCAGTAGG - Intronic
1183919539 22:41153860-41153882 CTGGGGGGTTGCCATGGAGTGGG - Intronic
949172016 3:1011447-1011469 CAGGGATGTTTCCATGGAGAAGG - Intergenic
949343913 3:3058971-3058993 CAAGGAGCTTACAATCTAGTTGG - Intergenic
950460064 3:13115867-13115889 CAGGCAGGTAGCCATGCAGTGGG - Intergenic
952446946 3:33390420-33390442 CAGGGAGTTTTCCATTTAATAGG - Intronic
952887961 3:38023065-38023087 CAGTGAGGTGGCCATGTGGTGGG + Intronic
954468131 3:50669363-50669385 CATGGAGTTTAGCATCTAGTTGG - Intergenic
955487628 3:59450542-59450564 CATGGAGTTTACCGTCTAGTTGG - Intergenic
955527871 3:59839429-59839451 CAAGGAGGTTACAATGTATCTGG - Intronic
955540765 3:59973636-59973658 CAGGGAGGTTACAATCTAGTGGG - Intronic
956024771 3:64971211-64971233 CCTGGAGTTTACCATCTAGTAGG - Intergenic
957927388 3:86832367-86832389 TAGGGAGTTTACTGTGTAGTTGG + Intergenic
958832612 3:99107865-99107887 CAAAGAGCTTACCCTGTAGTAGG + Intergenic
959009294 3:101056068-101056090 CAGGGCGGATACCTAGTAGTGGG + Intergenic
959737059 3:109671391-109671413 CAGAGAAGTTAGCATATAGTAGG + Intergenic
959782390 3:110250920-110250942 CAGGGAGATTACATTCTAGTGGG - Intergenic
960416956 3:117396749-117396771 CATGGAGGTTACAGTTTAGTTGG - Intergenic
962652196 3:137507906-137507928 CAGAGTGGGTGCCATGTAGTAGG + Intergenic
963533889 3:146504009-146504031 CAGGGAGGTAAGAATGTAGTGGG - Intergenic
963544313 3:146636266-146636288 CAGGGAGGTCCCCAAGTAGCGGG - Intergenic
965924272 3:173958480-173958502 CAGGGAGGAGACCCTGGAGTGGG + Intronic
966278498 3:178203980-178204002 CAGGGAGCTTAGCCTGGAGTAGG - Intergenic
971149234 4:24013511-24013533 CAGGGAGGTTACAGTCTATTAGG - Intergenic
971237353 4:24854763-24854785 CAGGGAGGTGAGCATGAGGTGGG - Intronic
974165305 4:58193747-58193769 CTGGGTGGATACCCTGTAGTGGG - Intergenic
974433266 4:61826089-61826111 CATGGACTTTACCTTGTAGTGGG + Intronic
975060479 4:69991383-69991405 CAGGCAGTTTACACTGTAGTTGG + Intergenic
977393221 4:96439964-96439986 CTAGGAGCTTACCATCTAGTGGG - Intergenic
977429941 4:96919486-96919508 CATGGAGCTTACAATTTAGTGGG + Intergenic
982356984 4:154481637-154481659 CTGGGAGTTTACCATGTGCTAGG + Intronic
982573795 4:157082365-157082387 CATGGAGCTTACAATCTAGTGGG - Intronic
985142066 4:186850600-186850622 CATGGAGGTCACCATTTAGAAGG + Intergenic
987029235 5:13960706-13960728 CAGGGAGGTGAGCATGGAGCCGG - Intergenic
988918788 5:35921835-35921857 CAGGCAGGTTACCAGGCAGATGG - Intronic
992493168 5:77265654-77265676 GAGGGAAGGTACTATGTAGTAGG - Intronic
992987849 5:82251763-82251785 CTAGGAGGTTTCTATGTAGTGGG - Intronic
993887102 5:93427516-93427538 CAGGAAGTTTACAATGTAGCTGG - Intergenic
993888056 5:93439920-93439942 CAAGGAGGTTACTGTCTAGTTGG - Intergenic
994392745 5:99205698-99205720 CAGGGTGTTTACAATGTAGAGGG + Intergenic
995631566 5:114139129-114139151 CAGAGAGGTTGCCATGTAAATGG - Intergenic
996284932 5:121778650-121778672 CAGGGTAGATACCCTGTAGTGGG + Intergenic
997481108 5:134185177-134185199 CAGGGAGCTTACCATCTAGTGGG + Intronic
997691294 5:135829204-135829226 CAGGGAGTTTAGCATATAGCAGG + Intergenic
1001692008 5:173640097-173640119 CATGGAGGTACACATGTAGTTGG + Intergenic
1002356550 5:178634021-178634043 CATGGAGGTTAGGATGTAGTGGG + Intergenic
1003486382 6:6583596-6583618 CAGGGAGATTAACTTTTAGTGGG - Intergenic
1003757560 6:9138665-9138687 CAGGGAGCTTAAAATTTAGTTGG - Intergenic
1007195024 6:40052948-40052970 CAAGGAGGTAACCATGTCCTTGG + Intergenic
1007620919 6:43213918-43213940 CAGAGAGGGGACCATGAAGTTGG + Intronic
1007719453 6:43876523-43876545 CAGGGAGGTGGCCAAGAAGTGGG - Intergenic
1007965310 6:45999051-45999073 CAGGGAGTTTACAATATACTTGG - Intronic
1011562331 6:88633164-88633186 CAAGGAGCTTACCATCTAATGGG - Intronic
1012233867 6:96790288-96790310 CAGGGAGCTTAGCATCTAGTAGG + Intergenic
1012303646 6:97622391-97622413 CAGGGAGATTACATTCTAGTGGG - Intergenic
1012634650 6:101522792-101522814 CATGGAGCTTACAATGTAGAAGG - Intronic
1012966850 6:105684479-105684501 CATGGAGGTTACATTCTAGTGGG + Intergenic
1015471475 6:133611450-133611472 CAGGGAGCTAACAATCTAGTGGG - Intergenic
1016809575 6:148246955-148246977 CAAGGAGTTTACAATCTAGTGGG + Intergenic
1017309588 6:152959769-152959791 CAGGGAAGTAACCATGTCTTTGG - Intergenic
1018181421 6:161226732-161226754 CAGAGAGGTTACCATAGAGGAGG + Intronic
1020407145 7:7849662-7849684 CATGGAGTTTACCATTTAGTAGG + Intronic
1020991966 7:15209537-15209559 CTGGGAGGTTCCCATTTACTGGG - Intronic
1024977382 7:55126230-55126252 CAGGAAGCTTACCATCCAGTGGG - Intronic
1025849985 7:65237489-65237511 CAGTGAGGTTACCATGGGGAGGG - Intergenic
1027246828 7:76373315-76373337 CAGGGAGGTTCCACTGAAGTGGG + Intergenic
1028854375 7:95574406-95574428 CATGGAGCTTAGCATTTAGTGGG - Intergenic
1029488202 7:100856023-100856045 CAGGGAGCTAACCATCTAATCGG + Intronic
1032636340 7:133713315-133713337 GAGGGAGGTCACAATCTAGTTGG - Intronic
1036584672 8:10112614-10112636 CAGGGAGCTTAGCACATAGTAGG - Intronic
1038891282 8:31727162-31727184 TAAGGAGCTTACCATCTAGTGGG + Intronic
1041530490 8:58860322-58860344 CACAGTGGTGACCATGTAGTTGG + Intronic
1041646595 8:60259014-60259036 CAGGGAGTTTTTCATGCAGTGGG - Intronic
1044830725 8:96245139-96245161 CAAGGAGCTTACAATCTAGTGGG - Intronic
1047350914 8:124072719-124072741 CAGGGAAGTCACAGTGTAGTTGG + Intronic
1047785067 8:128146263-128146285 CAAGGAGCTTACCATTTAGGTGG + Intergenic
1048063895 8:130948690-130948712 CAGGCAGTTTACCATGAAGAGGG + Intronic
1050588738 9:7140765-7140787 CATGGAGTTTACAATCTAGTGGG + Intergenic
1052200586 9:25774054-25774076 CAAGGAAGTGACCATGTCGTTGG - Intergenic
1053390022 9:37728014-37728036 CAGAGAGTTTAACATCTAGTGGG + Exonic
1053468792 9:38330424-38330446 CAGGGAGGTCACCAGGAATTGGG - Intergenic
1055650759 9:78404732-78404754 AAAGGAGTTAACCATGTAGTGGG - Intergenic
1055928051 9:81531096-81531118 GAAGGAGCTTACTATGTAGTGGG + Intergenic
1056618402 9:88188645-88188667 CAGGGAGGTTACCAAGGAAGTGG - Intergenic
1059780440 9:117520874-117520896 CAGGGAGCTTGCCATCTTGTGGG + Intergenic
1062389576 9:136328540-136328562 CAGGGAGGTCACCAGGTTTTAGG - Intronic
1187352549 X:18534094-18534116 CAGTGAGGTTACCAGGTAGTAGG - Intronic
1189117463 X:38357948-38357970 GAGGGAGGATACAATGTTGTGGG - Intronic
1190985039 X:55492292-55492314 CAGGGAGGGTGCCATGGACTGGG + Intergenic
1191960837 X:66700210-66700232 CTGGAAAGATACCATGTAGTGGG + Intergenic
1192425756 X:71074708-71074730 TAGGGAGTTTACAATGTGGTTGG - Intergenic
1192536398 X:71932067-71932089 CAGGGAGCTAAGCATTTAGTGGG + Intergenic
1193170494 X:78330053-78330075 GAGGGGGGATAACATGTAGTTGG + Intergenic
1195392702 X:104379496-104379518 CAGGGAGGTTACTTTCTAATAGG - Intergenic
1195464570 X:105166216-105166238 CAGGAAGCTTACCTTCTAGTGGG - Intronic
1195697991 X:107680879-107680901 CAAGGAAATTACCATGTAGCTGG + Intergenic
1198795067 X:140385771-140385793 CAGGGAGTTTACATTCTAGTGGG - Intergenic
1199124868 X:144105666-144105688 CAGGGAGCTTACCATCTCATTGG - Intergenic
1199527491 X:148808707-148808729 CAGGGACTTTTCCATGTAGAAGG + Intronic
1201418140 Y:13768928-13768950 CATGGAAATGACCATGTAGTGGG - Intergenic