ID: 1101254715

View in Genome Browser
Species Human (GRCh38)
Location 12:102965750-102965772
Sequence TCCCGGGCCCGCGGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101254715_1101254725 22 Left 1101254715 12:102965750-102965772 CCTGCTCCCCCGCGGGCCCGGGA No data
Right 1101254725 12:102965795-102965817 GCAGCCAGCCCCACCGCCTCCGG No data
1101254715_1101254722 -7 Left 1101254715 12:102965750-102965772 CCTGCTCCCCCGCGGGCCCGGGA No data
Right 1101254722 12:102965766-102965788 CCCGGGAAGCTTGCACTACCGGG No data
1101254715_1101254720 -8 Left 1101254715 12:102965750-102965772 CCTGCTCCCCCGCGGGCCCGGGA No data
Right 1101254720 12:102965765-102965787 GCCCGGGAAGCTTGCACTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101254715 Original CRISPR TCCCGGGCCCGCGGGGGAGC AGG (reversed) Intergenic