ID: 1101254773

View in Genome Browser
Species Human (GRCh38)
Location 12:102966178-102966200
Sequence CAGGCTCAAGAACTTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101254773_1101254781 14 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254781 12:102966215-102966237 AGAGGGCGGCTGCTTCTGTTGGG No data
1101254773_1101254780 13 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254780 12:102966214-102966236 CAGAGGGCGGCTGCTTCTGTTGG No data
1101254773_1101254777 -4 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254777 12:102966197-102966219 CCTGCAGGGTCAGCAGTCAGAGG No data
1101254773_1101254782 15 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254782 12:102966216-102966238 GAGGGCGGCTGCTTCTGTTGGGG No data
1101254773_1101254779 0 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254779 12:102966201-102966223 CAGGGTCAGCAGTCAGAGGGCGG No data
1101254773_1101254783 16 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254783 12:102966217-102966239 AGGGCGGCTGCTTCTGTTGGGGG No data
1101254773_1101254784 22 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254784 12:102966223-102966245 GCTGCTTCTGTTGGGGGAATTGG No data
1101254773_1101254778 -3 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254778 12:102966198-102966220 CTGCAGGGTCAGCAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101254773 Original CRISPR CAGGCTCAAGAACTTCATCC AGG (reversed) Intergenic