ID: 1101254776

View in Genome Browser
Species Human (GRCh38)
Location 12:102966197-102966219
Sequence CCTCTGACTGCTGACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101254776_1101254781 -5 Left 1101254776 12:102966197-102966219 CCTGCAGGGTCAGCAGTCAGAGG No data
Right 1101254781 12:102966215-102966237 AGAGGGCGGCTGCTTCTGTTGGG No data
1101254776_1101254782 -4 Left 1101254776 12:102966197-102966219 CCTGCAGGGTCAGCAGTCAGAGG No data
Right 1101254782 12:102966216-102966238 GAGGGCGGCTGCTTCTGTTGGGG No data
1101254776_1101254780 -6 Left 1101254776 12:102966197-102966219 CCTGCAGGGTCAGCAGTCAGAGG No data
Right 1101254780 12:102966214-102966236 CAGAGGGCGGCTGCTTCTGTTGG No data
1101254776_1101254784 3 Left 1101254776 12:102966197-102966219 CCTGCAGGGTCAGCAGTCAGAGG No data
Right 1101254784 12:102966223-102966245 GCTGCTTCTGTTGGGGGAATTGG No data
1101254776_1101254783 -3 Left 1101254776 12:102966197-102966219 CCTGCAGGGTCAGCAGTCAGAGG No data
Right 1101254783 12:102966217-102966239 AGGGCGGCTGCTTCTGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101254776 Original CRISPR CCTCTGACTGCTGACCCTGC AGG (reversed) Intergenic