ID: 1101254783

View in Genome Browser
Species Human (GRCh38)
Location 12:102966217-102966239
Sequence AGGGCGGCTGCTTCTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101254776_1101254783 -3 Left 1101254776 12:102966197-102966219 CCTGCAGGGTCAGCAGTCAGAGG No data
Right 1101254783 12:102966217-102966239 AGGGCGGCTGCTTCTGTTGGGGG No data
1101254773_1101254783 16 Left 1101254773 12:102966178-102966200 CCTGGATGAAGTTCTTGAGCCTG No data
Right 1101254783 12:102966217-102966239 AGGGCGGCTGCTTCTGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101254783 Original CRISPR AGGGCGGCTGCTTCTGTTGG GGG Intergenic