ID: 1101257015

View in Genome Browser
Species Human (GRCh38)
Location 12:102988701-102988723
Sequence TTAGAGAACCAGCACCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101257015_1101257021 7 Left 1101257015 12:102988701-102988723 CCCAGATGGTGCTGGTTCTCTAA No data
Right 1101257021 12:102988731-102988753 GACAACAATTTGATTAGCATGGG No data
1101257015_1101257022 8 Left 1101257015 12:102988701-102988723 CCCAGATGGTGCTGGTTCTCTAA No data
Right 1101257022 12:102988732-102988754 ACAACAATTTGATTAGCATGGGG No data
1101257015_1101257020 6 Left 1101257015 12:102988701-102988723 CCCAGATGGTGCTGGTTCTCTAA No data
Right 1101257020 12:102988730-102988752 GGACAACAATTTGATTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101257015 Original CRISPR TTAGAGAACCAGCACCATCT GGG (reversed) Intergenic
No off target data available for this crispr