ID: 1101259802

View in Genome Browser
Species Human (GRCh38)
Location 12:103017379-103017401
Sequence CAGGGTCAATAATTTAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101259795_1101259802 1 Left 1101259795 12:103017355-103017377 CCTTTCCAATGAGGGGAGGACCT No data
Right 1101259802 12:103017379-103017401 CAGGGTCAATAATTTAGAATGGG No data
1101259796_1101259802 -4 Left 1101259796 12:103017360-103017382 CCAATGAGGGGAGGACCTCCAGG No data
Right 1101259802 12:103017379-103017401 CAGGGTCAATAATTTAGAATGGG No data
1101259793_1101259802 6 Left 1101259793 12:103017350-103017372 CCTCTCCTTTCCAATGAGGGGAG No data
Right 1101259802 12:103017379-103017401 CAGGGTCAATAATTTAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101259802 Original CRISPR CAGGGTCAATAATTTAGAAT GGG Intergenic
No off target data available for this crispr