ID: 1101263789

View in Genome Browser
Species Human (GRCh38)
Location 12:103063591-103063613
Sequence CTGTTGCCTCAGGTGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101263789_1101263794 -5 Left 1101263789 12:103063591-103063613 CCCTGTGCCACCTGAGGCAACAG No data
Right 1101263794 12:103063609-103063631 AACAGTGATGGCCTTCCCTGAGG 0: 12
1: 131
2: 153
3: 123
4: 258
1101263789_1101263796 6 Left 1101263789 12:103063591-103063613 CCCTGTGCCACCTGAGGCAACAG No data
Right 1101263796 12:103063620-103063642 CCTTCCCTGAGGCAGTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101263789 Original CRISPR CTGTTGCCTCAGGTGGCACA GGG (reversed) Intergenic
No off target data available for this crispr