ID: 1101264132

View in Genome Browser
Species Human (GRCh38)
Location 12:103066133-103066155
Sequence GACAGCTCTTGGCCAATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101264129_1101264132 15 Left 1101264129 12:103066095-103066117 CCTGTCATCTTCTGCAGATAACT 0: 21
1: 199
2: 184
3: 120
4: 249
Right 1101264132 12:103066133-103066155 GACAGCTCTTGGCCAATTACTGG No data
1101264128_1101264132 16 Left 1101264128 12:103066094-103066116 CCCTGTCATCTTCTGCAGATAAC No data
Right 1101264132 12:103066133-103066155 GACAGCTCTTGGCCAATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101264132 Original CRISPR GACAGCTCTTGGCCAATTAC TGG Intergenic
No off target data available for this crispr