ID: 1101264874

View in Genome Browser
Species Human (GRCh38)
Location 12:103073764-103073786
Sequence TCCTTTCCATGTAGTCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101264874_1101264877 6 Left 1101264874 12:103073764-103073786 CCAACCTGACTACATGGAAAGGA No data
Right 1101264877 12:103073793-103073815 GTTAATTGAGTCTCAAATGTGGG No data
1101264874_1101264876 5 Left 1101264874 12:103073764-103073786 CCAACCTGACTACATGGAAAGGA No data
Right 1101264876 12:103073792-103073814 TGTTAATTGAGTCTCAAATGTGG No data
1101264874_1101264878 12 Left 1101264874 12:103073764-103073786 CCAACCTGACTACATGGAAAGGA No data
Right 1101264878 12:103073799-103073821 TGAGTCTCAAATGTGGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101264874 Original CRISPR TCCTTTCCATGTAGTCAGGT TGG (reversed) Intergenic