ID: 1101269273

View in Genome Browser
Species Human (GRCh38)
Location 12:103126019-103126041
Sequence TCCAGGGCAGTGAGTGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101269265_1101269273 17 Left 1101269265 12:103125979-103126001 CCCTAACTCAGAGTTACTATGCT No data
Right 1101269273 12:103126019-103126041 TCCAGGGCAGTGAGTGCAATTGG No data
1101269266_1101269273 16 Left 1101269266 12:103125980-103126002 CCTAACTCAGAGTTACTATGCTG No data
Right 1101269273 12:103126019-103126041 TCCAGGGCAGTGAGTGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101269273 Original CRISPR TCCAGGGCAGTGAGTGCAAT TGG Intergenic
No off target data available for this crispr