ID: 1101272613

View in Genome Browser
Species Human (GRCh38)
Location 12:103163456-103163478
Sequence CTCAAACACAAGGGCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101272613_1101272619 -8 Left 1101272613 12:103163456-103163478 CCAGGACTGCCCTTGTGTTTGAG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1101272619 12:103163471-103163493 TGTTTGAGCTGAGGGCTGGATGG 0: 1
1: 0
2: 1
3: 36
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101272613 Original CRISPR CTCAAACACAAGGGCAGTCC TGG (reversed) Intronic
901093042 1:6655806-6655828 CTCAAAAACAAGAACAGGCCGGG + Intronic
902875475 1:19338303-19338325 CTCAAACACATGGGCTGGCCAGG + Intergenic
907530021 1:55085739-55085761 CCCAAACACCAGGGTAGGCCAGG - Intronic
907746022 1:57214377-57214399 CTCAAACCAAAGGGCAGTTGAGG - Intronic
908972881 1:69858471-69858493 CACAAAGACAAGGGCCATCCAGG + Intronic
909464460 1:75957789-75957811 ATCTAATATAAGGGCAGTCCAGG + Intergenic
910475254 1:87598915-87598937 CTGAGACACCAGGGCAGTGCTGG + Intergenic
919938789 1:202272342-202272364 CCCAAACACAAACACAGTCCTGG + Intronic
920303052 1:205001254-205001276 CTCAACCACAAAGTCAGTTCCGG - Exonic
923890786 1:238213284-238213306 CACAATCAAAAGGGCAGTGCAGG - Intergenic
924897977 1:248362708-248362730 ATCAAACACCATGGCAGTCTTGG - Intergenic
1063134365 10:3203507-3203529 CTCTAACACAAGGCCACTCCTGG - Intergenic
1064279841 10:13941663-13941685 CTCAGACAGAAGGGCAGGCCAGG + Intronic
1066381598 10:34906591-34906613 CACAAACACATGGGGCGTCCTGG + Intergenic
1068942549 10:62693787-62693809 CTCGAACCCAAGGGAAGACCTGG - Intergenic
1072559288 10:96555547-96555569 ATGAAACTGAAGGGCAGTCCAGG + Intronic
1073357959 10:102871804-102871826 CTCAATAACTAGCGCAGTCCTGG + Intronic
1074284846 10:112088455-112088477 CTCAGCCACCAGGGCTGTCCTGG - Intergenic
1077674787 11:4186612-4186634 CTCAAACACTGGGGTAGGCCGGG + Intergenic
1078986589 11:16604668-16604690 CTCACACACAAAAGCAGCCCAGG + Intronic
1081201069 11:40215757-40215779 TGCAAACACAAAGGCAGTCTGGG + Intronic
1081557613 11:44180527-44180549 ATCAAGCACAAGTGAAGTCCAGG + Intronic
1083901023 11:65643577-65643599 CTGAAACACAGGAGCAGTACTGG + Intronic
1084671496 11:70609223-70609245 ATCAGACACAAAGGCAGCCCTGG + Intronic
1086403990 11:86484530-86484552 CACACACACACAGGCAGTCCGGG - Intronic
1086492162 11:87366458-87366480 CTCAAAGACAAGGGCAGGTTGGG - Intergenic
1088585167 11:111355036-111355058 CCCAGACACAAAGACAGTCCGGG + Intronic
1089252317 11:117173793-117173815 ACCAGACACAAGGGCAGCCCTGG + Intronic
1090246393 11:125218847-125218869 CTCCAACCCTAGAGCAGTCCTGG - Intronic
1099750979 12:86772228-86772250 ATCAAACATGAGGACAGTCCAGG - Intronic
1101272613 12:103163456-103163478 CTCAAACACAAGGGCAGTCCTGG - Intronic
1102304102 12:111791728-111791750 TTTAACCACAATGGCAGTCCTGG - Intronic
1102366531 12:112341302-112341324 CTCAAACAGAAGTGCTGACCTGG - Intronic
1103828131 12:123756612-123756634 CTCAAACACTAAGGAAGACCTGG - Intronic
1104196980 12:126549837-126549859 TTCAAACAGAAGTGCAGACCTGG + Intergenic
1105280324 13:18959400-18959422 CTCAAGGCCCAGGGCAGTCCAGG - Intergenic
1106303820 13:28493977-28493999 CTGACCCACAAGGGCAGCCCAGG - Intronic
1110903301 13:80852527-80852549 ATCAAAGACAAGGGCAGAACTGG - Intergenic
1113556713 13:111241426-111241448 CTCAAACACACAGCCAGGCCTGG - Intronic
1113639955 13:111950069-111950091 CTCAAACACAGTGGGACTCCTGG - Intergenic
1114596495 14:23916833-23916855 CACAAGAACAAGGGAAGTCCCGG + Intergenic
1121016547 14:90552620-90552642 CCCACACAGAAGGGCAGTGCAGG + Intronic
1121017543 14:90557657-90557679 CTCAAACAAGATGGCAGCCCTGG + Intronic
1122828992 14:104386585-104386607 GACAAACACAACGGCATTCCTGG + Intergenic
1124612504 15:31217761-31217783 CTCAAACACACGGCCAGGCGCGG - Intergenic
1126193933 15:45910645-45910667 CTCAAACACTAAGGCATGCCAGG - Intergenic
1126210956 15:46099625-46099647 CTCTAACACAAGGACAGCACTGG - Intergenic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1130766449 15:86876232-86876254 CTCAAACACAAGGGAAGGCGGGG + Intronic
1132859344 16:2062349-2062371 CCCAGACACAAAGGCACTCCTGG - Intronic
1133225632 16:4339053-4339075 CTGGGACAGAAGGGCAGTCCGGG - Exonic
1136028216 16:27483714-27483736 CACACACACAAGGGCAGGGCAGG + Intronic
1138658646 16:58504675-58504697 CCCAAACACCAGGGCAAGCCAGG + Intronic
1140864810 16:79050608-79050630 CTCAAATACAAGTGCAGTCTTGG - Intronic
1141618359 16:85222649-85222671 CTCCAACACAAATGAAGTCCAGG + Intergenic
1142549513 17:729814-729836 CCCAAACCCAAAGGCAGACCTGG + Intergenic
1152757855 17:82094417-82094439 CTCACACCCAAGGGCAGCCCAGG + Intronic
1155625871 18:27833969-27833991 CTCAAACCCAAGTGCATACCTGG - Intergenic
1156336909 18:36180723-36180745 CTCAAACACAAAGGAATTACTGG + Intergenic
1163498749 19:17663078-17663100 CTCTAACAGAACGGCAGGCCAGG - Intronic
1165095177 19:33406350-33406372 CTCATACACATGGACAGGCCTGG - Intronic
1165332454 19:35148423-35148445 CTCAAACTACATGGCAGTCCTGG - Intronic
1165714706 19:38036833-38036855 CTCCAAGACAGGGGCAGGCCGGG - Intronic
1167306158 19:48710942-48710964 CTCCAGCCCAAGGGCAGTCCTGG - Intergenic
925478944 2:4248698-4248720 CTCCAACTCAAGGGCAGGGCTGG + Intergenic
926526492 2:13987467-13987489 CCCAAACCCTAGGCCAGTCCTGG - Intergenic
928276113 2:29901638-29901660 ATCAAACAACAGGGCTGTCCAGG + Intronic
930700646 2:54456156-54456178 CACACACACAAGCGCACTCCCGG - Intergenic
930968865 2:57369238-57369260 CTCAAAGAAAAGGGAAGTCCAGG - Intergenic
932008441 2:67951368-67951390 CTAAAGGACAAGGGCTGTCCTGG + Intergenic
932800250 2:74735492-74735514 CTCAAACACAAAGAAAGACCTGG - Intergenic
932888612 2:75570624-75570646 CTCAAAGACAAGGGCATGACAGG + Intergenic
938277277 2:130037816-130037838 CTCAAACACTAGGGCGCCCCGGG + Intergenic
938328249 2:130428619-130428641 CTCAAACACTAGGGCGCCCCGGG + Intergenic
938361698 2:130692875-130692897 CTCAAACACTAGGGCGCCCCGGG - Intergenic
938438107 2:131299562-131299584 CTCAAACACTAGGGCGCCCCGGG - Intronic
940760948 2:157738686-157738708 CTCATACCTCAGGGCAGTCCTGG + Intronic
941175165 2:162188494-162188516 CTCAAAATCAAGAGGAGTCCAGG + Intronic
943993990 2:194735572-194735594 ATCACACACCAGGGCAGTCGGGG + Intergenic
944220130 2:197295252-197295274 CTCTAACTCAAGGGCAGACTTGG - Intronic
944689635 2:202147895-202147917 CTCAAACACAGGCACAGTTCCGG + Intronic
949011257 2:241680160-241680182 CTCGCATTCAAGGGCAGTCCTGG + Intronic
1168916214 20:1490508-1490530 CTCTAACTCAGGGGCAGGCCAGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171531597 20:25856883-25856905 CTAGAAGACAAGGCCAGTCCCGG + Intronic
1180150918 21:45947369-45947391 CTCATACACAGTGGCAGTTCCGG - Intergenic
1183518463 22:38282061-38282083 ATCACACACAAGGCCAGGCCCGG - Intergenic
952285157 3:31961226-31961248 CTCACCCACAAGGACAGTACAGG - Intronic
952851358 3:37732453-37732475 TTCAAACCCTAGGGCAGTCCTGG - Intronic
954097797 3:48344262-48344284 CTAAGACACAAGGGCAGGCGCGG + Intergenic
954235677 3:49255408-49255430 CTCAAACACCAGGTCATTCTGGG - Exonic
956616304 3:71176257-71176279 CCCAAACACAAGGGCAATAAAGG + Intronic
959945236 3:112119085-112119107 GTCAAAAACAAAGGCAGTCTGGG + Intronic
960358379 3:116680207-116680229 CTAAAATACAAGGGCAGGACAGG - Intronic
961078668 3:124005370-124005392 CTCAAACAGAAGTACAGCCCTGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
962165981 3:133048551-133048573 CTCTAAAACAAGGCCAGTGCAGG + Intronic
964939505 3:162138662-162138684 ATCAAAGAGAAGGGCATTCCAGG + Intergenic
965621293 3:170644665-170644687 CACAAACACAAGGGCCGGCAGGG + Intronic
967270840 3:187730959-187730981 CTCAAACAGAAGGGTTTTCCAGG - Intronic
968021708 3:195397343-195397365 CACTGACCCAAGGGCAGTCCTGG + Intronic
969884377 4:10202199-10202221 CCCATAGTCAAGGGCAGTCCAGG - Intergenic
970275794 4:14399181-14399203 CTCAGAGTCAAGGGCAGTCAAGG + Intergenic
970707120 4:18817382-18817404 CTCAAACACAAGATAAGTCTTGG + Intergenic
983493595 4:168417655-168417677 CTAAACCACAAGGTCAGTACTGG + Intronic
983735431 4:171052963-171052985 TTCAAACATTAAGGCAGTCCAGG + Intergenic
986059563 5:4175205-4175227 CTCAAACACAAATACAGGCCTGG + Intergenic
986559102 5:9042820-9042842 CTCAGAAACATGGGCAGTCATGG + Exonic
987766335 5:22236440-22236462 CTAAAACACAAGGCCAGGCACGG + Intronic
988962588 5:36384898-36384920 CTCAAACACAAGGATGTTCCAGG + Intergenic
992123753 5:73620909-73620931 CTGAAACACAAGGGTAGTTTGGG - Intergenic
992896285 5:81247932-81247954 CTCAGACACAAGGGCAGTATTGG + Intronic
995991946 5:118250272-118250294 GTCAAACATATGGGCTGTCCTGG - Intergenic
996422748 5:123280055-123280077 TCCAAAAACAAGGGCAGTGCTGG - Intergenic
998627181 5:143859462-143859484 ATCACACACAAAGCCAGTCCTGG - Intergenic
999254826 5:150204509-150204531 CTAAAACACAAGCACAGTTCTGG - Intronic
1001584719 5:172826116-172826138 CTCAAACACAAGGGCTTACAGGG - Intergenic
1002876872 6:1218489-1218511 CTAAAACAGAAGAGCAGTCCTGG + Intergenic
1003814955 6:9829123-9829145 CTCAATGACATGGGCAGTCATGG - Intronic
1008536010 6:52506684-52506706 ATCCAACACAAGGGCAGAGCTGG + Intronic
1009165169 6:60331953-60331975 CTCAAACACTAGGACAGGCACGG - Intergenic
1010712600 6:79192670-79192692 CTCAACCTCAAGGCCACTCCTGG - Intergenic
1015965506 6:138692832-138692854 ATCCAACACAAAGGAAGTCCCGG + Intergenic
1016231503 6:141810916-141810938 CTCAAACTCTAGGGAAGGCCTGG - Intergenic
1017487324 6:154915360-154915382 TTAAACCACAAGTGCAGTCCAGG + Intronic
1019413825 7:918536-918558 CTCTTACACAAGGGCAGTGGGGG + Intronic
1020656783 7:10937576-10937598 ATCAAAACCAAGGGCAGGCCAGG - Intronic
1025300793 7:57818586-57818608 CTAAAAGACAAGGCCAGTCACGG - Intergenic
1026458176 7:70591084-70591106 GTCACACACAAAGGCAGGCCAGG - Intronic
1029224255 7:99013729-99013751 CTCCCACACGAGGGCAGGCCTGG - Intergenic
1030388843 7:108900436-108900458 CTCTAAGAAAAGGGCAGTCAGGG - Intergenic
1031448623 7:121886022-121886044 CTTAAATACAAGGGGAGTGCTGG + Intronic
1039391020 8:37180819-37180841 ATCAAACAGAATGGCAGCCCAGG + Intergenic
1041640052 8:60188595-60188617 GTTATACACAAGGGAAGTCCAGG + Exonic
1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG + Intergenic
1044704781 8:94998005-94998027 CTCTAACTCAAGAGCAGCCCAGG - Intronic
1047365946 8:124211627-124211649 CTCTAACATAAGGGCAGTGTTGG + Intergenic
1049101738 8:140584571-140584593 TTTAAACACATGGGCAGTCTAGG - Intronic
1051676437 9:19563188-19563210 CTAGAACACAAGAGCAGTGCTGG - Intronic
1056483014 9:87025006-87025028 CTCAAACTCAAAGGCAGTTGTGG - Intergenic
1057272576 9:93659168-93659190 CTCAAGGCCCAGGGCAGTCCAGG + Intronic
1059375865 9:113880998-113881020 CTCAGCCACATGGGCAGCCCAGG + Intronic
1061706119 9:132454754-132454776 CTCAATAACAAGGGCAATGCTGG - Intronic
1185964306 X:4583182-4583204 CTCTCAGACAAGGGCATTCCGGG + Intergenic
1187583052 X:20630181-20630203 ATCAAAGGCAAGGGCAGACCTGG + Intergenic
1194692246 X:97001347-97001369 TTAAAACACAAAGCCAGTCCAGG + Intronic
1195289543 X:103418965-103418987 CATAAACACAAGGCCATTCCTGG - Intergenic
1196436309 X:115677802-115677824 CTCAAAAACAAGAACAGGCCAGG + Intergenic
1197123066 X:122914219-122914241 CTGGTACACAAGGGTAGTCCTGG + Intergenic
1201286369 Y:12382033-12382055 CTGAAAAACAAGGTCAGGCCAGG - Intergenic