ID: 1101276563

View in Genome Browser
Species Human (GRCh38)
Location 12:103208178-103208200
Sequence TTGTGCAAATAATTTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101276563_1101276570 8 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276570 12:103208209-103208231 CTGGGGTGACAAATGAAGAGGGG No data
1101276563_1101276573 30 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276573 12:103208231-103208253 GCTGGCCCATTGAAGATGCTGGG No data
1101276563_1101276566 -10 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276566 12:103208191-103208213 ATTTGCACAAAAGGTGCGCTGGG No data
1101276563_1101276567 -9 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276567 12:103208192-103208214 TTTGCACAAAAGGTGCGCTGGGG No data
1101276563_1101276572 29 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276572 12:103208230-103208252 GGCTGGCCCATTGAAGATGCTGG No data
1101276563_1101276571 12 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276571 12:103208213-103208235 GGTGACAAATGAAGAGGGGCTGG No data
1101276563_1101276569 7 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276569 12:103208208-103208230 GCTGGGGTGACAAATGAAGAGGG No data
1101276563_1101276568 6 Left 1101276563 12:103208178-103208200 CCAATGGGAAATTATTTGCACAA No data
Right 1101276568 12:103208207-103208229 CGCTGGGGTGACAAATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101276563 Original CRISPR TTGTGCAAATAATTTCCCAT TGG (reversed) Intergenic
No off target data available for this crispr