ID: 1101281898

View in Genome Browser
Species Human (GRCh38)
Location 12:103266316-103266338
Sequence TCTTTATTTTAGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 526}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101281896_1101281898 4 Left 1101281896 12:103266289-103266311 CCAAGACTGGTTGTATTTATATC 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG 0: 1
1: 0
2: 5
3: 46
4: 526
1101281895_1101281898 5 Left 1101281895 12:103266288-103266310 CCCAAGACTGGTTGTATTTATAT 0: 1
1: 0
2: 1
3: 23
4: 278
Right 1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG 0: 1
1: 0
2: 5
3: 46
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101281898 Original CRISPR TCTTTATTTTAGAAAGTGGA TGG Intronic
901859582 1:12065385-12065407 TTTTTATTTTAAAAAGGGTATGG - Intronic
901880341 1:12190174-12190196 TCTTTCTTTTATTAACTGGAAGG + Intronic
902033041 1:13436629-13436651 TCTGTAACATAGAAAGTGGAGGG + Intergenic
902112007 1:14088244-14088266 TTTTTATGTTAGAAAGAAGAAGG - Intergenic
906632458 1:47383675-47383697 TCTTTATGCTAGAGAGTGGTGGG + Intergenic
907609858 1:55857839-55857861 TGTTTATTTTAGGGAGTGGAGGG - Intergenic
908930631 1:69312764-69312786 ACTTTGGTTTAGAAAGGGGATGG + Intergenic
910779681 1:90916202-90916224 TTTTTATACTAAAAAGTGGAGGG - Exonic
911072775 1:93846085-93846107 TCTTTATATTATAAAGGGGACGG + Intronic
911135371 1:94433656-94433678 TCTTTTTTTTAGACAGTGTCTGG + Intronic
911214955 1:95182831-95182853 TTTTTTTTTTAAGAAGTGGATGG + Intronic
911436283 1:97863204-97863226 TCTTTATCAAAGAAAGGGGAGGG - Intronic
913027501 1:114859545-114859567 TCTTTATTTTAGATTGATGAAGG + Intronic
913443629 1:118926154-118926176 GATTTATTTTGGAAAGAGGAAGG - Intronic
914393051 1:147239194-147239216 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
914817275 1:151072143-151072165 TGTTTATTTAAGAATCTGGATGG - Intronic
916153018 1:161814495-161814517 TCTTCATTTTAAAAAATAGAAGG + Intronic
916749400 1:167710598-167710620 TCTTTATTTTAGAAAATTGGTGG + Intergenic
918553000 1:185765790-185765812 GCTTTACTTAAGAAACTGGATGG + Intronic
918675645 1:187281755-187281777 ACTTTATGTCAGAAAGTAGAAGG + Intergenic
918904946 1:190479029-190479051 TCTCTTTTTTAGAAATAGGAGGG + Intergenic
919025130 1:192158619-192158641 TCTTCATTTTAGAGAGAAGATGG + Exonic
919445883 1:197704543-197704565 TCTTTTTTTGATACAGTGGAGGG - Intronic
920397615 1:205658545-205658567 TATTTATTTAACAAAGTAGAAGG - Exonic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
921394075 1:214650265-214650287 TATTTTTTTTAGAAATTGAAAGG + Intronic
922608837 1:226909198-226909220 TCTTTCTAATGGAAAGTGGATGG - Intronic
922630969 1:227110573-227110595 TTTTTATTTGAGAAAATTGAGGG - Intronic
923104697 1:230845058-230845080 AATTTATTTTAGAAAGAGGCAGG - Intronic
923220882 1:231891882-231891904 TCTGCATTGTAGAAAGGGGAAGG - Intronic
924101073 1:240603259-240603281 TCTTTGTATTTGAAACTGGATGG - Intronic
924311701 1:242750624-242750646 TATTTATTTAAAAAAGTGGCCGG + Intergenic
924357794 1:243201789-243201811 TCTTTATTTATGAAACAGGAGGG - Intronic
924954000 1:248909998-248910020 TCTGTATGTTAGCAAGTGGATGG + Intronic
1063679557 10:8173835-8173857 TTTTGATTTTAAAAATTGGAAGG - Intergenic
1063693526 10:8310154-8310176 TATATATATTAGAATGTGGATGG - Intergenic
1063809658 10:9690421-9690443 TCTTTATTTTCTAAAGAAGATGG - Intergenic
1064184688 10:13151249-13151271 TCTGCATTTTAAAAAGTGCAAGG - Intergenic
1064937247 10:20691874-20691896 TTTTTATTTTTCAAAGTGAAAGG - Intergenic
1065060772 10:21898824-21898846 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1065116728 10:22490439-22490461 TATTTATTTTAGAGATGGGATGG + Intergenic
1065460778 10:25961616-25961638 ACTTGAATTTACAAAGTGGAGGG + Intronic
1066322364 10:34316906-34316928 TATTTATTTTAGAGAGAGAATGG + Intronic
1068261113 10:54583371-54583393 ATTTTATTTTACTAAGTGGAGGG + Intronic
1069537425 10:69265373-69265395 ACTTTATTTTTTAAAGTTGATGG + Intronic
1069999150 10:72363369-72363391 TGTTTATTTAAAAAAGTGGACGG - Intergenic
1070265746 10:74901128-74901150 TAATTATTTTATAAAATGGAGGG - Intronic
1071580343 10:86763414-86763436 TCTTTATCTTAAAAAATAGAAGG + Intronic
1072290981 10:93964322-93964344 TCTTTGATTAAGAAAGTGTAAGG + Intergenic
1072962203 10:99939606-99939628 GTTTAGTTTTAGAAAGTGGAAGG - Intronic
1073982604 10:109172144-109172166 TCTTGAGCTTAGAAAGTAGATGG + Intergenic
1074280723 10:112049025-112049047 TCTTAATTTAAGGAAGAGGAGGG - Intergenic
1074333969 10:112549669-112549691 TCATTATTTTGGACAGTGGAAGG + Intronic
1075131573 10:119744319-119744341 TCTTTGTTTTAGCAAGGGGAAGG - Intronic
1075392412 10:122101876-122101898 TCTTTTTTTTAAAAAAAGGATGG - Intronic
1076398005 10:130155565-130155587 TTTTGATTTTAGGAACTGGATGG + Intronic
1077593290 11:3509484-3509506 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1077611133 11:3643611-3643633 TCCTTATTTTAGAATCTGGGAGG - Intergenic
1077739388 11:4828549-4828571 TATCTATTTTAGAAAGCGGGGGG + Intronic
1078181229 11:9013028-9013050 GCTCTATTTTAAAAAGGGGAGGG - Intergenic
1078345771 11:10546674-10546696 GCTCTATTTTACAAAGTTGAAGG - Intergenic
1079042889 11:17075282-17075304 TTTTCATTATAGAAAGTGCATGG - Intronic
1080233988 11:30047566-30047588 GCTTTATTTTAAAAAATTGAGGG - Intergenic
1080471937 11:32554259-32554281 TGCTTATTTTACAAAGTAGATGG - Intergenic
1080523029 11:33084752-33084774 GTTTTATTTTAAAAACTGGATGG - Exonic
1080920932 11:36708635-36708657 TTTTTATTTTAGAAAGAGTTGGG + Intergenic
1082772644 11:57220244-57220266 TATTTATTATAGAGACTGGATGG + Intergenic
1082854538 11:57794803-57794825 TCTTTATTTTAGACTGGGCACGG + Intronic
1082952475 11:58831976-58831998 TCTTTTTATTAGAAATTGGGAGG + Intergenic
1083105268 11:60351505-60351527 TCTTTATTTTAGGAATAGAATGG + Intronic
1084249118 11:67882202-67882224 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1084286117 11:68132162-68132184 TGGTTATTTAAGAAAGAGGAAGG + Intergenic
1084823690 11:71713268-71713290 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1085717626 11:78887022-78887044 TTTTTATTTTAGAAAGGTAAGGG - Intronic
1086226618 11:84519309-84519331 TCATCATTTTAGCAAGTTGATGG + Intronic
1086396833 11:86423888-86423910 ACTTTGGTTTAGAAAGGGGAAGG - Intergenic
1086547725 11:88017740-88017762 TATATATTTTATAAAGAGGAAGG + Intergenic
1086883535 11:92177049-92177071 TCTTTATGTTAGAGAGGTGAAGG - Intergenic
1087082422 11:94184444-94184466 ATTTTATTTTAGAGAGGGGAAGG + Intergenic
1087304289 11:96470931-96470953 TCTTTATTTCAGAACGTTTAGGG - Intronic
1088013558 11:105033265-105033287 TCTTTAATTTAGAGAGTGGTGGG + Intronic
1088016682 11:105069638-105069660 TCTTTAATTTAGAGAGTGGTGGG + Intronic
1088019233 11:105099556-105099578 TCTTTAATTTAGAGAGTCGTGGG + Intronic
1089760470 11:120718966-120718988 ACCTTATTCTAGAAAGGGGAGGG - Intronic
1089822887 11:121244912-121244934 TCTTTATTTTAAGCAATGGAAGG - Intergenic
1090225274 11:125067638-125067660 TATTTAATTTAAAAAGAGGAAGG - Intronic
1090369106 11:126234983-126235005 AATCTATTTTAGAAACTGGATGG + Exonic
1090883407 11:130854502-130854524 TCATTATTGTAGAAATGGGAAGG - Intergenic
1091135899 11:133189095-133189117 TCTTGATTTGGGCAAGTGGATGG - Intronic
1091485408 12:882155-882177 TCTTTATTTTATGAAGTGAGTGG - Intronic
1091485520 12:883762-883784 TGTTTGTTGTAGAAATTGGAAGG + Exonic
1091889358 12:4040850-4040872 CCTTTCTCTTGGAAAGTGGATGG - Intergenic
1092081953 12:5723679-5723701 TTTTTATTTTTGACAGTGCATGG - Intronic
1092419409 12:8317624-8317646 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1092575924 12:9782657-9782679 TGTTTATTATAGCAAGGGGAAGG - Intergenic
1092582577 12:9860966-9860988 ACTATATTTTGGAAAGTGAAAGG + Intronic
1093066418 12:14662911-14662933 TCTTCATCTTACAAAGTGGGAGG + Intronic
1093225487 12:16478632-16478654 TTTTAATTTCAGAAAGTGGGAGG + Intronic
1094262302 12:28515005-28515027 TCTTTTTTTAAAAAAGTTGAGGG - Intronic
1094345536 12:29464393-29464415 TCTATCTTTTAGAAAGAAGAGGG + Intronic
1095661344 12:44740786-44740808 TCTGAATTTTAGAAAGAGGCAGG + Intronic
1095683012 12:45000590-45000612 TCTCTGTTTTACAGAGTGGATGG - Intergenic
1096939771 12:55329518-55329540 TCTTTTTATTAGAATGTTGAAGG + Intergenic
1097214059 12:57396072-57396094 AATTTATGTTAGAAAGTGGTAGG - Intronic
1097987505 12:65799387-65799409 TCTTAATTTCACGAAGTGGAGGG + Intergenic
1098048259 12:66425169-66425191 TCCTTCTTTTAGAAATTTGAAGG + Intronic
1098448876 12:70596506-70596528 TTTTTTTTTAAGAAAGTGAAAGG - Intronic
1099706045 12:86154143-86154165 ATTGTATTTGAGAAAGTGGAAGG + Intronic
1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG + Intergenic
1100560669 12:95746392-95746414 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1100577136 12:95902898-95902920 TCTTTCTTGTAGAAATTGAAAGG - Intronic
1101281898 12:103266316-103266338 TCTTTATTTTAGAAAGTGGATGG + Intronic
1101287094 12:103326100-103326122 TCTTTATTTGAAAAAATGGAGGG - Intronic
1101761366 12:107661480-107661502 TTTTTTTTTTTGAAAGAGGAAGG - Intergenic
1102963280 12:117107529-117107551 TCTTTATATGTGAAAGAGGAAGG + Intergenic
1103356248 12:120323076-120323098 TATCTATTATGGAAAGTGGAAGG - Intronic
1104768856 12:131347351-131347373 CATTCATTTCAGAAAGTGGAGGG - Intergenic
1104812111 12:131625660-131625682 ACTTTGGTTTAGAAAGTGGAAGG - Intergenic
1105257483 13:18753701-18753723 ACTTTGGTTTAGAAAGGGGAAGG - Intergenic
1105260143 13:18773016-18773038 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1105533908 13:21246186-21246208 ACTTTATATTAGTCAGTGGAAGG - Intergenic
1105769836 13:23598492-23598514 TCTTTATTTAAGACACTGGCAGG - Intronic
1106241860 13:27919339-27919361 TCTTTTTTTTAAAAAATTGAAGG - Intergenic
1106342651 13:28845545-28845567 ACTTCATTTAAGAAATTGGAAGG + Intronic
1106448311 13:29856576-29856598 TCTTTATTTTAAAAACAGAAAGG - Intergenic
1109204641 13:59467662-59467684 TCTTTATTTTACAAATGAGAAGG - Intergenic
1109647088 13:65272971-65272993 ACATTATTTTTAAAAGTGGATGG - Intergenic
1109667263 13:65555776-65555798 TGTTTGATTTAGAAAGTGGGAGG - Intergenic
1110639110 13:77801491-77801513 TCTTAATTTTATAAAATTGAAGG + Intergenic
1111081358 13:83312643-83312665 TTTCTATTTTGGAAAGTGGGGGG + Intergenic
1111100639 13:83580527-83580549 TCTTTATTATAGAAAATGTTAGG - Intergenic
1111188917 13:84782428-84782450 CTTTTATTTTAGAAATTGGTAGG + Intergenic
1111350827 13:87028730-87028752 TCTTGATAGTAGAATGTGGATGG + Intergenic
1112629412 13:101144253-101144275 TTCTTCTTTTAAAAAGTGGAAGG + Intronic
1112975342 13:105310968-105310990 TCTTTATTTTGGAAAGGTAAAGG - Intergenic
1114610774 14:24038721-24038743 ACTTTATTTTCCAGAGTGGAAGG + Intergenic
1115293673 14:31801680-31801702 TCTTTACTTAATAAAGTGAAGGG - Intronic
1115348509 14:32368050-32368072 TCTTTTTTCTAGAAATTTGAAGG + Intronic
1115666583 14:35556034-35556056 TTTTTATTTTAGAACATGCAAGG - Intronic
1115759786 14:36568384-36568406 ACTATATTTTAAAAAATGGAAGG + Intergenic
1116006942 14:39303351-39303373 TCTTTATTGTAGCAAGAAGAGGG + Intronic
1117542303 14:56760145-56760167 CTTTTATTTAAGAAAGTGGCTGG - Intergenic
1117556533 14:56891790-56891812 TCCTTGTTTTATAAGGTGGAGGG - Intergenic
1119829741 14:77691144-77691166 TCTTTTTTTTCCAAAGTGAATGG - Intronic
1119835015 14:77741343-77741365 TCTCTATTTTAAAGAATGGATGG + Intronic
1119999249 14:79283887-79283909 TCCATATTTTAAAAAGTGCAAGG + Intronic
1120440161 14:84526390-84526412 TCTTTGTTTTAGAAACTGTTGGG - Intergenic
1120863965 14:89279642-89279664 TGTTAATTTTTGAGAGTGGAGGG + Intronic
1122351377 14:101095285-101095307 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1122483831 14:102065121-102065143 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1124094228 15:26633825-26633847 ACTTTGGTTTAGAAAGGGGAAGG - Intronic
1124712769 15:32029644-32029666 GCTTGATTTTGGAAAGAGGAAGG - Intergenic
1125454396 15:39842603-39842625 TCTTTATGGTGGAAAGGGGAAGG - Intronic
1125642862 15:41246224-41246246 TCTTCTTTGTAGAAAGTGGGTGG + Intronic
1126822786 15:52521268-52521290 TCTCTAGTTTAGAAAGATGAAGG - Intronic
1126945114 15:53810648-53810670 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1127116284 15:55730943-55730965 TCTTTACTTAAGGAAGAGGAAGG + Intronic
1127865413 15:63028677-63028699 TCCTTCTTTTAGAAAGTTGCTGG + Intergenic
1128734609 15:70046062-70046084 TCTGTTTTTTAAAAAATGGAGGG - Intergenic
1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132008221 15:98250043-98250065 TCTTTTATTTGGAAAGTGGAAGG - Intergenic
1133570550 16:7036004-7036026 TCATTATTTAAGAAATGGGAAGG - Intronic
1133669150 16:8000504-8000526 TCTTTATTTTAGCTTTTGGAAGG - Intergenic
1134264652 16:12682811-12682833 TCTTTATTTTTAAAAGAAGATGG + Intronic
1135162200 16:20106779-20106801 TTTTGATTTTATTAAGTGGAAGG - Intergenic
1135337389 16:21614710-21614732 CCTTTATTTTGGAAAGGAGAAGG + Intronic
1135587270 16:23680422-23680444 TTTTTATTTTTTAAATTGGAAGG + Intronic
1135793050 16:25415755-25415777 TCTTTATTTTGGCATGTGAATGG - Intergenic
1136521773 16:30801356-30801378 TCTTTTTTTTAGAGAGAGAAAGG + Intergenic
1137006278 16:35276663-35276685 TCCTTTGTTTAGAAAGGGGAGGG + Intergenic
1137070719 16:35902153-35902175 ACTTTAGTTTAGAGAGGGGAGGG + Intergenic
1137403831 16:48174995-48175017 TTTATTTTTTAGAAACTGGATGG - Intronic
1138790296 16:59895893-59895915 TGTTTATTTTAAAAAGAGTAGGG + Intergenic
1139967700 16:70754817-70754839 TGTTTGTTTTGGAGAGTGGATGG + Intronic
1140924316 16:79567931-79567953 TCTTTATTTTCCAAAGAGGCAGG + Intergenic
1141301911 16:82824288-82824310 TCATTATTTTAGAAACGGAAAGG + Intronic
1143611915 17:8022819-8022841 TGTTTTTTCAAGAAAGTGGAAGG + Intergenic
1143729826 17:8874995-8875017 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1145762767 17:27435782-27435804 TCTTTATTCTAGAAAGTTATTGG - Intergenic
1145832656 17:27929476-27929498 TCCTTATTTTAGGAAATGGTTGG - Intergenic
1146886869 17:36476792-36476814 TCTTTATTTCAGGCAGTGAAAGG + Intergenic
1147981570 17:44277884-44277906 TCTTTATTTCAGACAGAGAAGGG + Intergenic
1149038897 17:52163492-52163514 TCTTTTTTTTATATAGTGTAAGG - Intergenic
1149056153 17:52368719-52368741 TTTTTTTTTTACAAATTGGAAGG + Intergenic
1151041283 17:70863385-70863407 TCTTTCTTTAAAAAAATGGAAGG - Intergenic
1151486011 17:74400786-74400808 TCCGTATTTTAAAAAGTGGGGGG - Intergenic
1151920945 17:77155127-77155149 TCTTTAGTTTATAAAGTGACAGG - Intronic
1152390240 17:79999845-79999867 TGTTCATTTTAGAAATTCGAGGG - Intronic
1153751386 18:8234729-8234751 TCTTTTTTTTATCAAGTTGAGGG + Intronic
1153799142 18:8653805-8653827 TCTTTTTTGTAGAGAGTGCAAGG - Intergenic
1154425884 18:14271784-14271806 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1154433572 18:14327026-14327048 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155729253 18:29131821-29131843 GTTTGATTTTAGCAAGTGGATGG + Intergenic
1156957452 18:42985720-42985742 TCTTTATTGTATATAGTGTATGG - Intronic
1157293093 18:46423851-46423873 TCTTTATTTTAGAACAGGTAAGG - Intronic
1158521466 18:58174761-58174783 TGTTAATTTTTGATAGTGGAGGG - Intronic
1158715890 18:59879497-59879519 TTTTTATTTAAGAAAGTGAGTGG - Intergenic
1159038812 18:63303431-63303453 TCTTTATTTTAATAACTAGAAGG - Intronic
1159056136 18:63465761-63465783 TTTTTTTTTTAGACAATGGAAGG + Intergenic
1159653601 18:71005537-71005559 TCTTTATGTTTGAGGGTGGAAGG - Intergenic
1162078223 19:8203158-8203180 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1164219422 19:23179880-23179902 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1164220202 19:23186411-23186433 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1165253892 19:34560967-34560989 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1165273175 19:34727629-34727651 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1165523223 19:36330621-36330643 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1165658565 19:37554876-37554898 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1166502054 19:43348968-43348990 ACTTTATGTTATAAAGAGGAGGG - Intergenic
1166508059 19:43384484-43384506 ACTTTATGTTATAAAGAGGAGGG + Intergenic
1166580229 19:43891395-43891417 GCTTTATTTTAGAAATTCAAAGG + Intronic
1167326622 19:48830471-48830493 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1168127330 19:54292611-54292633 TCTTTATTCTAGAGGGTAGATGG + Intergenic
1168127335 19:54292685-54292707 TCTTTATTCTAGAGGGTAGATGG + Intergenic
1168173022 19:54602047-54602069 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173031 19:54602158-54602180 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173034 19:54602195-54602217 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173046 19:54602343-54602365 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168515066 19:57004075-57004097 TATTTAATTTTGAAAGTGCATGG - Intergenic
1168615078 19:57830896-57830918 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
926423667 2:12722033-12722055 TCTTCATTTTATGAAGAGGAGGG + Intronic
926664292 2:15503233-15503255 TTTTTTTTTTAGTAAGTAGAAGG + Intronic
927027553 2:19085203-19085225 TCTTTTTTTTAGACAGTGCCTGG + Intergenic
927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG + Intergenic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
927767870 2:25829745-25829767 TCTTTATTTTTGAGACTTGAGGG - Intronic
929623595 2:43383339-43383361 TCTTTATTTTACCAAGAAGATGG - Intronic
930176525 2:48306635-48306657 ACTTTATTTACAAAAGTGGAAGG + Intergenic
930304233 2:49658119-49658141 TCTCTAGTCCAGAAAGTGGAAGG - Intergenic
930354413 2:50299672-50299694 TCTTTATTTTTAAAAGTTAAAGG + Intronic
930367951 2:50465875-50465897 TTTTGATTTTAGAAAATGAATGG + Intronic
930751095 2:54934723-54934745 TCTTTATTTTAGAGATGGGGTGG + Intronic
931335934 2:61343528-61343550 TCTATATTTTAGAAAATATATGG - Intronic
932181192 2:69647703-69647725 TATTTTTTTTAAAAAGTGGCTGG - Intronic
932546965 2:72722515-72722537 TCTTTGTTTAAGTAAATGGAGGG + Intronic
932855911 2:75233935-75233957 TCTGTATTTTGGCAAGTGGAGGG - Intergenic
933267621 2:80199248-80199270 TCTTTAATTTAGAAAATTCAAGG + Intronic
935522526 2:104125268-104125290 GCTTTATTTCAGACAGTGGGAGG - Intergenic
935620488 2:105125777-105125799 TGGTTAATTTAGAAAGAGGAAGG + Intergenic
935660184 2:105459973-105459995 TCTTTATTCTAGAAAGTTTAAGG + Intergenic
935819813 2:106883503-106883525 TACTAATTTTGGAAAGTGGAAGG - Intronic
936118982 2:109725328-109725350 TCTTGATGCCAGAAAGTGGAGGG + Intergenic
936448703 2:112617275-112617297 TATTTTTTTTAGGTAGTGGAAGG + Intergenic
936908054 2:117559936-117559958 TTATTCTTTTTGAAAGTGGAAGG - Intergenic
937597840 2:123691366-123691388 ACTTTGGTTTAGAAAGGGGACGG - Intergenic
938095824 2:128462578-128462600 TCTTTATTTTAGACAGGGTCTGG - Intergenic
939103411 2:137921978-137922000 GCCTTCTTTTAGAAAGAGGAAGG + Intergenic
939425244 2:142027260-142027282 TCTTTATTTAAAAAAATGAAAGG - Intronic
939529097 2:143335274-143335296 TTTTTAATTTAGAAAGTTGAAGG - Intronic
939690440 2:145253862-145253884 GCTTTCTTTTAGAATGTGGTGGG + Intergenic
940087559 2:149877862-149877884 TATTAATTTAAGAAAGTGGAAGG + Intergenic
940198887 2:151128142-151128164 GCTTTATTTTAGAAAGTTGAGGG - Intergenic
940611649 2:156000173-156000195 TCTTTATAAGAGAAAGAGGAAGG - Intergenic
940709881 2:157149048-157149070 TTTTTTTTTTGGAAAGGGGAAGG - Intergenic
941285345 2:163605698-163605720 TCTGTATTTTGCAAAGTGAAAGG - Exonic
941951961 2:171164947-171164969 TCTTTTTTTTAGATAGAGGTGGG - Intronic
942381632 2:175397835-175397857 TGTTTCATTTAGAAAATGGAAGG - Intergenic
942432717 2:175931075-175931097 TCTTTAATGTAGAAATTGGGTGG - Intronic
943883524 2:193180555-193180577 TACTTATTTTAGAAAATGAAAGG - Intergenic
944219256 2:197286007-197286029 TCTTTACTTTATAAATTGGGTGG - Intronic
944580279 2:201126174-201126196 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
945204028 2:207312605-207312627 GTTTTGTGTTAGAAAGTGGAGGG - Intergenic
945580770 2:211592036-211592058 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
946992944 2:225356132-225356154 TCTATAATTTAGTATGTGGATGG + Intergenic
947948625 2:234128152-234128174 TCTATATTTTAGTAATAGGAAGG - Intergenic
948744424 2:240076283-240076305 TGTTTATTTGATAAAGGGGATGG - Intergenic
1169796472 20:9468243-9468265 TCTGTATTTTGGAAAAAGGAGGG - Intronic
1170279713 20:14632625-14632647 TATTTAGTCTGGAAAGTGGAAGG + Intronic
1170316638 20:15048799-15048821 TCTATAATTGAGAATGTGGATGG - Intronic
1170460426 20:16572726-16572748 ACTTCATGTTAGAGAGTGGATGG - Intronic
1170733956 20:18997684-18997706 TTTTAATCTAAGAAAGTGGATGG + Intergenic
1171072664 20:22090589-22090611 TCTTTATTTACAAAAGAGGATGG - Intergenic
1172176478 20:32975511-32975533 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1173632085 20:44524171-44524193 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1174737696 20:52981378-52981400 TTTATAGATTAGAAAGTGGAGGG - Intronic
1174962104 20:55170117-55170139 CCTTTTTTTGAGAAAGTGGAAGG + Intergenic
1175362221 20:58421666-58421688 TCATTATTTTAAAGAGAGGAGGG + Intronic
1175582183 20:60108772-60108794 TTTTTTTTTTAGTAAGTAGAAGG - Intergenic
1176807338 21:13499465-13499487 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1176843464 21:13858719-13858741 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1176846143 21:13878045-13878067 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1177118150 21:17110049-17110071 CCTAGATTTTAGAAAGTGTATGG - Intergenic
1177331835 21:19674520-19674542 TCTCTATTTTATAAAGGGCAAGG - Intergenic
1179200378 21:39213228-39213250 TCTATATTTTAGCTAGTGAAAGG - Intronic
1179295031 21:40054158-40054180 TCTTTTTTTGGGAAAGGGGAAGG - Intronic
1179347835 21:40577681-40577703 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1179493654 21:41757691-41757713 TTTTTATTTTAAAAAATGGCTGG - Intronic
1179669536 21:42936842-42936864 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1181166346 22:20985373-20985395 TCTTTTTTTTAAGAAGTGGCAGG + Intronic
1181790087 22:25258436-25258458 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1182314141 22:29432459-29432481 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1184356432 22:43983321-43983343 TCAATTTTTCAGAAAGTGGATGG + Intronic
949639765 3:6022744-6022766 TCTTTATATTAGAAAGCACAAGG - Intergenic
950490083 3:13299336-13299358 TTCTTATTATAGAAAGTAGAGGG - Intergenic
951742664 3:25941539-25941561 TCTTTCATTTAGAAAAAGGAAGG - Intergenic
951891046 3:27568449-27568471 TCTTCATTTTAGAAACAGAAAGG - Intergenic
952414589 3:33079411-33079433 TATTTATTTTAGCAAGAGGAGGG + Intronic
952716050 3:36482205-36482227 TCATTATTTCAGAAAGTGGCTGG - Intronic
952721862 3:36541977-36541999 TCTTTATGTTAGAGAGAGGGAGG + Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953760916 3:45686220-45686242 ACTTTGGTTTAGAAAGGGGAGGG - Exonic
955902070 3:63767177-63767199 TGTATATCCTAGAAAGTGGAAGG + Intergenic
956013710 3:64858852-64858874 TCAATATTTTAGAAAGTCCAGGG - Intergenic
957063387 3:75500374-75500396 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
957179301 3:76856548-76856570 ACTTAATTTAAGAAAGTGTAGGG - Intronic
957697610 3:83661610-83661632 TTTTTCTTTTAGAAATAGGATGG - Intergenic
958208977 3:90443533-90443555 TCTTTTTTTTAGAATATGCAAGG - Intergenic
958941526 3:100321050-100321072 TCTTTATTTTGGGGAATGGATGG + Intronic
959062919 3:101632441-101632463 ACTTTGGTTTAGAAAGGGGATGG - Intergenic
959064371 3:101641901-101641923 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
959610147 3:108284919-108284941 TTTTTATTGTACTAAGTGGAAGG - Intergenic
959612706 3:108313236-108313258 TCTTTATTTTGGAAAAAGGCTGG + Intronic
959634232 3:108544248-108544270 TCTCTATTTAGGAAAGTGGGGGG - Intergenic
960294569 3:115927496-115927518 TCTTTCTTTTGGAAAGAAGAAGG - Intronic
960323466 3:116265934-116265956 TCTTTAGTTTAAAAAGTTGTGGG + Intronic
960926349 3:122798375-122798397 ACCTTATTTTATAAAGTGAATGG - Intronic
961290008 3:125839200-125839222 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
961413847 3:126743263-126743285 TCTTTGTTTAAGAAGCTGGAAGG + Intronic
961568412 3:127780903-127780925 TCTTAATTTTAAAAAGTGTTAGG + Intronic
961855423 3:129865452-129865474 TCCTTATTTTAAGAAGTGCAAGG - Intronic
961897092 3:130176820-130176842 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
962202454 3:133413009-133413031 TCTGTTTCTTAGAAAGTGGAGGG + Intronic
963100704 3:141600773-141600795 TTTTTATTTTAAAAACTGGCTGG - Intronic
963167883 3:142224060-142224082 TTTTTATGTTAGAAATTTGAGGG - Intronic
963524888 3:146405142-146405164 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
963525751 3:146411738-146411760 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
963612393 3:147486479-147486501 TCTCCATTTTAGAAAGCAGATGG + Intronic
964144966 3:153448722-153448744 AGTTTATATTAGAAAGTCGAAGG - Intergenic
964208271 3:154199077-154199099 TCTTTATTTTAAAATGTAGGGGG + Intronic
964538826 3:157756714-157756736 TCTACATTTTACAAAGTGGAAGG + Intergenic
964681919 3:159350580-159350602 TATTTATTTTTGAAAAGGGATGG + Intronic
964761898 3:160142226-160142248 TCTTTTTTTCTGAAAGTGGCAGG + Intergenic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
964783924 3:160372921-160372943 TGTTTATTTTAGAGAGGGGATGG - Intronic
965167537 3:165214939-165214961 TCATTATTTTAAATAGTTGACGG + Intergenic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965983466 3:174722378-174722400 TCTTTATTTAAGCAATAGGAGGG - Intronic
966092272 3:176154536-176154558 AATTTATTTTTGAAAGTAGAAGG - Intergenic
966387287 3:179412839-179412861 TTTTTTTTTTCCAAAGTGGAGGG - Intronic
966763105 3:183434379-183434401 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
966958780 3:184912109-184912131 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
967149994 3:186639724-186639746 TCTTTCTTTTAGCAAGAGTATGG + Intronic
967193987 3:187010915-187010937 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
967469645 3:189846979-189847001 TCTTTAATAAAGAATGTGGAAGG - Intronic
968160092 3:196419497-196419519 GCTTTGTTTAAGAAAGTGGATGG - Intronic
968401564 4:303234-303256 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
969007271 4:4030378-4030400 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
969179580 4:5427427-5427449 TATTTTTTTTAGAAAATAGAAGG - Intronic
969646011 4:8429317-8429339 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
969746339 4:9075680-9075702 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
969804947 4:9600228-9600250 ACTTTAGTTTAGAAAGGGGAAGG - Intergenic
970108021 4:12607037-12607059 AATTTATTTTAGAAATTTGAAGG - Intergenic
970157456 4:13155342-13155364 TTTTTTTTTTTGAAAGTAGAAGG - Intergenic
970669501 4:18379893-18379915 CCTTTATTATAGAGACTGGAAGG + Intergenic
971611768 4:28734790-28734812 TAATTATTTTATAAAGTGTAAGG + Intergenic
971882435 4:32394916-32394938 ACTTTATTTTAGAAAAGAGAAGG + Intergenic
972062303 4:34891148-34891170 TCTATTTTTTAGAAATTGGCTGG + Intergenic
972103346 4:35449044-35449066 TCTTTACTTTAAAAAATGCAGGG + Intergenic
972971304 4:44579606-44579628 ACTGTATCTTAGAAAGTGGAGGG - Intergenic
974367224 4:60965936-60965958 ACTTTATTTTAGAAAGCGAAAGG - Intergenic
974827153 4:67145953-67145975 TCTCTACTTTAGAAAGAAGAAGG - Intergenic
975258389 4:72267537-72267559 TGTGTGTTTTAGAAAGTAGAAGG + Intergenic
975509664 4:75180596-75180618 TCTTGATTTTTGAATGTGTAAGG - Intergenic
976295794 4:83470386-83470408 TCTGTATTTCAGAATGTGGTAGG - Exonic
976457238 4:85262428-85262450 ACTATCTTTAAGAAAGTGGAAGG - Intergenic
977256026 4:94740930-94740952 TTCTAATTTAAGAAAGTGGATGG - Intergenic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977497310 4:97793974-97793996 TTTTTATTTTAAAAAATGCATGG + Intronic
978195714 4:105969510-105969532 CCCTTATTTTATAAAGTGAATGG - Intronic
978254984 4:106682243-106682265 TCTTTAATTTAGTAATAGGAGGG - Intergenic
978752442 4:112266069-112266091 TCTTTTTTTTGGAAAGGGAAGGG - Intronic
978796469 4:112712765-112712787 AATTTATTTTAGACAGTGAAGGG + Intergenic
979129870 4:117030517-117030539 TATTTATTATAGAAAGTAAAGGG - Intergenic
979244010 4:118477691-118477713 TCTTTATTTATGAAACAGGAAGG + Intergenic
979296608 4:119039778-119039800 TTTTTAATTTAAAAATTGGAAGG - Intronic
979351640 4:119650485-119650507 TGTTTTTTTAAGAAAGTGGATGG + Intergenic
979588777 4:122452769-122452791 TTTTTATTTTAAAAAGTGTTTGG + Intronic
979876683 4:125900451-125900473 TGTTTATTTTTGAAAATGTAAGG - Intergenic
979962111 4:127033598-127033620 TGTTTATTTTAGTTATTGGATGG - Intergenic
980062064 4:128141933-128141955 TATTTATTTCAGATAGTGAAAGG + Intronic
980086478 4:128395763-128395785 TCCTTATCCTACAAAGTGGATGG - Intergenic
980143902 4:128956779-128956801 TCTTTATTTTATCCAGTGGAGGG + Intronic
980645627 4:135638822-135638844 TTTTTTTTTTAGAAATTTGAAGG + Intergenic
980971526 4:139571840-139571862 TCCTCATTTTAGAAAGAGGCAGG - Intronic
981083133 4:140655199-140655221 TGTTCATTTTAGAAATTGTAGGG - Intronic
981559198 4:146028641-146028663 TGTTGATTTTAAAAAGGGGATGG + Intergenic
982028158 4:151273092-151273114 ACTTTATTTTGAAAATTGGAAGG - Intronic
982895570 4:160919012-160919034 TCTTTATTTTAGAAATGATATGG - Intergenic
983395249 4:167185810-167185832 TTTTTATTTTAGAAACTCGTTGG - Intronic
983813716 4:172096736-172096758 TCTTTATTTTAAAACATGAATGG - Intronic
984177985 4:176443080-176443102 TCTTTTTTTTAGAAAAAGAAAGG - Intergenic
986133241 5:4949869-4949891 TAATTTTTTTACAAAGTGGAAGG + Intergenic
986641607 5:9877227-9877249 CTTATTTTTTAGAAAGTGGATGG + Intergenic
986678400 5:10210871-10210893 TCTCTATTTTAAAAAGAGAAAGG + Intergenic
987206780 5:15635549-15635571 TTTTTAATTTATAGAGTGGATGG + Intronic
987616832 5:20285062-20285084 TCTTTATTTATGAGAGGGGATGG - Intronic
987683330 5:21165324-21165346 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
987684823 5:21183447-21183469 TGTTTGTTTTAGAAAATTGAGGG - Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
987969440 5:24923154-24923176 TCTTATTTTTTAAAAGTGGAAGG + Intergenic
989065319 5:37455000-37455022 TGTATATTTTATAAAGTGCATGG + Intronic
989784102 5:45306294-45306316 TTTTTATTTTAGAAAATAGTTGG + Intronic
990019975 5:51114359-51114381 TCTTTATTTTAGCAAAAGAAGGG - Intergenic
990457273 5:56000071-56000093 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
990700875 5:58473825-58473847 TCTTTAATTTAAAAAATGGAGGG + Intergenic
991701479 5:69320155-69320177 TATTTATTTTAGATTTTGGAAGG + Intronic
992324759 5:75649939-75649961 GCACTATTTTAGATAGTGGAGGG - Intronic
994057279 5:95432220-95432242 AATTTATTTTAGAAAATGCAAGG - Intronic
994080193 5:95700230-95700252 TTTTTATTTTAGATAGTAGTGGG + Intergenic
995011560 5:107261590-107261612 TTATTATTTTAGCAATTGGATGG - Intergenic
995150439 5:108838349-108838371 TCATTACTTTAGACATTGGAAGG + Intronic
995909338 5:117167028-117167050 TTTTTATTTGAGCAAGTGGGAGG - Intergenic
996628367 5:125598294-125598316 TCATTATTTTAGAATGTTGTTGG + Intergenic
996802634 5:127420565-127420587 CCTTTATGGTAGAAAGTGGCAGG + Intronic
996946208 5:129072099-129072121 TATTTTGTTTGGAAAGTGGAAGG + Intergenic
996993416 5:129665109-129665131 TCTTTAGGTTAGAAAGTGTGGGG - Intronic
998918537 5:147042228-147042250 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
999670062 5:153951803-153951825 GATTTATTTTAGCAAGTAGATGG - Intergenic
999791010 5:154939248-154939270 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
999876197 5:155808814-155808836 TATTCATGTAAGAAAGTGGATGG + Intergenic
1000093572 5:157951097-157951119 TCTATATTTATGAATGTGGAGGG - Intergenic
1000105338 5:158053776-158053798 GTTTTATTTTAAAAAGTGGGTGG - Intergenic
1000175408 5:158747531-158747553 TGTTTGTTTTATAAAGTGGCAGG - Intronic
1000381778 5:160636109-160636131 TCTTTATTTTACAAAGTTGTAGG + Intronic
1000953922 5:167519492-167519514 TCCTTATTTTTTAAAGTGCATGG - Intronic
1001332164 5:170770114-170770136 TCTGCATTTTAGAAAGAGGGTGG + Intronic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003702611 6:8485889-8485911 TCTTTTATTTAAAAAGTGAATGG + Intergenic
1004069951 6:12288773-12288795 TTTTGATTTTAGAAGGAGGAGGG + Intergenic
1004100785 6:12608843-12608865 TCTTTGGTTGAGAAAGTGGAAGG - Intergenic
1004690811 6:17990579-17990601 TCTTTATTAGAGAAAGGAGAGGG + Intergenic
1004833597 6:19505399-19505421 CCTTGATTATGGAAAGTGGAAGG - Intergenic
1004860363 6:19797987-19798009 TATTTATATTATAAAGTGAAGGG + Intergenic
1005028670 6:21489215-21489237 TCATTCTATCAGAAAGTGGAGGG - Intergenic
1005433975 6:25788060-25788082 TCTTTATGTTAAGAAATGGAAGG - Intronic
1005561728 6:27047642-27047664 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1005737946 6:28766313-28766335 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1005739394 6:28776094-28776116 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1006754620 6:36404641-36404663 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1007018401 6:38493363-38493385 TCCTTATTATTGATAGTGGATGG + Intronic
1007855682 6:44853906-44853928 ACTTTATTCTAGATAGTTGAGGG + Intronic
1008513740 6:52300325-52300347 CCTTTATTTCAGAGAGTGGCTGG - Intergenic
1008593889 6:53021784-53021806 TTTTTTTTTTAGTAAGTAGAAGG - Intronic
1008956337 6:57220847-57220869 TTATTATTTTAAAAAGTGTATGG - Intronic
1009873218 6:69473858-69473880 TCGTTATTTTGTAATGTGGAAGG - Intergenic
1010145976 6:72669917-72669939 TTTTTTTTTTGGAATGTGGATGG + Intronic
1010211268 6:73364178-73364200 TCTGTATTTTGGAAGGTAGAGGG + Intergenic
1010219559 6:73436496-73436518 CTTTTATTTTAAAAAGGGGATGG - Intronic
1011355466 6:86468901-86468923 TCTTTATTATAGGACATGGAAGG - Intergenic
1012151048 6:95753678-95753700 TTTATATTTTAGAAAGTGGTGGG + Intergenic
1013060467 6:106629284-106629306 CCTTTTTTTTTTAAAGTGGAGGG - Exonic
1013487647 6:110612703-110612725 TTCTTATTTTAAAAAATGGAAGG + Exonic
1013507796 6:110816527-110816549 TCTTTATTTTAGGCAGTAGTGGG - Intronic
1014740013 6:125138514-125138536 GTTTTATTTTAGGAAGTTGAAGG - Intronic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1015004180 6:128258242-128258264 TCTTTATTATAGAAATTTTAAGG - Intronic
1015101070 6:129481375-129481397 TCATTCTTTTGGGAAGTGGAGGG + Exonic
1017191034 6:151652658-151652680 TCTTTGTTTTGGAATGGGGATGG + Intergenic
1017373574 6:153740907-153740929 TCTTTTTTTTAGAAAAAGTAAGG + Intergenic
1017686555 6:156919454-156919476 TACTAATTTTAGAAAGGGGATGG + Intronic
1018146101 6:160890499-160890521 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1018346617 6:162905502-162905524 TCTTTATTTTTGAAATTAAAGGG - Intronic
1019059466 6:169245247-169245269 TCTTCATTTTACAAAGATGAAGG - Intronic
1020327776 7:6988495-6988517 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1020331366 7:7020311-7020333 TCTTCATTTTAGAATGAAGATGG + Intergenic
1020724651 7:11796333-11796355 CCTTTTTTTTTCAAAGTGGATGG - Intronic
1021054130 7:16026147-16026169 TCTTGATTTGAAAAAGTTGAAGG - Intergenic
1021667660 7:23002411-23002433 TCTTCATGGTAGAAAATGGAAGG - Intronic
1021755829 7:23851170-23851192 TCTTCATTTTAATAATTGGAGGG - Intergenic
1022084424 7:27052724-27052746 TACTTTTTTTAGAAAATGGAAGG + Intergenic
1022092514 7:27116974-27116996 TCTATATTTTAAGAAGTGAAAGG + Intronic
1022537719 7:31108165-31108187 ACTTCATTTTATAAAGAGGAAGG + Exonic
1022587345 7:31626920-31626942 GCTTTCTTCTAGAAAGTGGATGG + Intronic
1022739531 7:33108466-33108488 ACTTTATTTTAGGCAGTTGAGGG - Intronic
1022777113 7:33538359-33538381 TCTTTATTGTATTAAGTGGATGG + Intronic
1026400789 7:70010867-70010889 TCTGGATATTAGAAATTGGAAGG + Intronic
1027959228 7:84922083-84922105 TCCTTATGTTAGAAGTTGGAAGG - Intergenic
1028899217 7:96077007-96077029 ATTTTATTTTATAAAGTTGAAGG - Intronic
1029142643 7:98422458-98422480 TATTTTTTTTAGTAAGTGGATGG - Intergenic
1030057435 7:105595779-105595801 TCTATATTTTAGAAAGAAGAAGG - Intronic
1030218550 7:107073353-107073375 TTTTTATTTTTGTAAGTGAAAGG + Intronic
1030383212 7:108837199-108837221 TCATTATTACAGAAAGTAGATGG + Intergenic
1030417903 7:109268330-109268352 TCTTTATTTTAGAAAAATGTTGG + Intergenic
1030715243 7:112801366-112801388 TCATTATTTTAGAAATATGATGG + Intergenic
1030944839 7:115705097-115705119 TTTTAATTTTATAAAGGGGAAGG - Intergenic
1031138219 7:117909817-117909839 TCTTTATTTAAGAAATGGCAAGG + Intergenic
1032211412 7:129917659-129917681 CCTTTATTTTAGAGAGAGCAGGG + Intronic
1032747989 7:134807431-134807453 TCTTGAGTTTAGAAACTGGTCGG - Intronic
1033171918 7:139092004-139092026 ACTTTGGTTTAGAAAGGGGAGGG + Intronic
1034496010 7:151422887-151422909 GCTTTGGTTTAGAAAGGGGAGGG + Intergenic
1034644812 7:152636024-152636046 TTTGTATTTTAGAAAATGTATGG + Intergenic
1035123096 7:156585356-156585378 TCTTTATTTGAGAACCTGGTGGG - Intergenic
1035967694 8:4212542-4212564 TCTTTATTTTAGAAAAAAAAAGG - Intronic
1036368842 8:8145598-8145620 ACTTTCGTTTAGAAAGGGGAGGG - Intergenic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1036730637 8:11260842-11260864 TTTTTATTTTTGAAATTGAAGGG + Intergenic
1036882047 8:12520044-12520066 ACTTTCGTTTAGAAAGGGGAGGG + Intergenic
1037338183 8:17812534-17812556 ACTGTATAATAGAAAGTGGAGGG - Intergenic
1038056581 8:23863994-23864016 TCTTGACTTGAGAAAATGGAGGG + Intergenic
1038640395 8:29319949-29319971 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1039508699 8:38071645-38071667 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1039699161 8:39944760-39944782 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1039718587 8:40137672-40137694 ACTTTATTTTATTAAGTAGAAGG + Intergenic
1041044520 8:53878427-53878449 TTTTTCTTTTGGAAAGTGGAGGG - Intronic
1041269754 8:56099815-56099837 TTTTGACTTTAGAAAGTGGCTGG + Intergenic
1041493678 8:58462837-58462859 ACTTTGGTTTAGAAAGGGGAGGG - Intergenic
1042383474 8:68147068-68147090 CATTTTTTTTAGAATGTGGAGGG - Intronic
1042684085 8:71418151-71418173 TCTTTAAGTTGGAAAGTGGGAGG - Intronic
1042691065 8:71499274-71499296 TCAATATCTTACAAAGTGGAAGG - Intronic
1043190309 8:77213000-77213022 TTTTGATTTTAAAAAGTGAATGG - Intergenic
1043613796 8:82100064-82100086 ATTTTATTTTAGAAAGTGTTAGG - Intergenic
1043660606 8:82736171-82736193 TCTAGATTTTAGAAAATGTATGG + Intergenic
1044230588 8:89772772-89772794 TCTCTCTAATAGAAAGTGGATGG + Exonic
1044325710 8:90855282-90855304 TATTTATTTTAGGAAGAGTAAGG + Intronic
1044867932 8:96590639-96590661 TTTTTATTTTTTAAAGGGGAAGG + Intronic
1045380400 8:101618207-101618229 TCCTCATTTTAAATAGTGGATGG - Intronic
1046337479 8:112808746-112808768 ACTTTGGTTTAGAAAGGGGAGGG - Intronic
1046602961 8:116339462-116339484 TCCATCTTTTTGAAAGTGGAAGG - Intergenic
1048699299 8:137069834-137069856 TCTTTATTCTAGGATGGGGAAGG - Intergenic
1049830161 8:144695652-144695674 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1050056907 9:1665224-1665246 TCTTTGTTTTTTAAAGAGGATGG - Intergenic
1050163579 9:2742280-2742302 ACTTTTTTTTCTAAAGTGGAAGG - Intronic
1050714131 9:8501493-8501515 TCTATATTCTAGAATGAGGATGG + Intronic
1051172071 9:14328939-14328961 GCTTTTTTTGAAAAAGTGGAAGG + Intronic
1052034265 9:23662273-23662295 TCATTATCTGATAAAGTGGATGG - Intergenic
1052130667 9:24842683-24842705 TCTTTTTTTTTGCATGTGGATGG + Intergenic
1052258738 9:26490829-26490851 TCTGGCTTTTGGAAAGTGGACGG - Intergenic
1052479663 9:29007705-29007727 TTTTTATTTTAGTAGCTGGATGG + Intergenic
1053334770 9:37257304-37257326 TCTTGATTTAGGCAAGTGGAAGG + Intronic
1053367405 9:37532949-37532971 CCTTTGTTTTATAAAGTGGAAGG - Intronic
1055007857 9:71529018-71529040 TCTTAATCTTAGAAAGGTGAGGG - Intergenic
1055009635 9:71550688-71550710 GCTTTATTTTAGAAATCGAATGG + Intergenic
1055995340 9:82151674-82151696 TCTTTATTGTAGAATGAGGAGGG + Intergenic
1056929227 9:90860980-90861002 TCCTCATTTTAGAAAATGCAGGG + Intronic
1057157641 9:92857711-92857733 TCCTTATGTTAGCAAATGGAGGG - Intronic
1057989614 9:99754672-99754694 TAATTATGTCAGAAAGTGGAAGG - Intergenic
1058527599 9:105875560-105875582 TGTCTATTTTTAAAAGTGGATGG + Intergenic
1059125649 9:111682298-111682320 TATTTATTTCACAAAGTGGAAGG + Intergenic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1059597065 9:115732457-115732479 TTTTTTTTTTAGAAAGGGCAGGG - Intergenic
1059599356 9:115759617-115759639 TTTTTATTTGAGAAACAGGACGG + Intergenic
1059798777 9:117728672-117728694 TTTTTATTTTAAAAAGAGGAGGG - Intergenic
1059906157 9:118989199-118989221 TTTTGACCTTAGAAAGTGGAGGG + Intergenic
1060011568 9:120047834-120047856 ACTTTATTTTAATAAGTAGAAGG + Intergenic
1061641879 9:131964714-131964736 GGTCTGTTTTAGAAAGTGGAAGG + Intronic
1185485259 X:477138-477160 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1186516812 X:10172457-10172479 TAGTTATTCTAGAAATTGGATGG + Intronic
1186567329 X:10677437-10677459 TCTTCTTTTTAAAAACTGGAGGG - Intronic
1187082993 X:16010902-16010924 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1187598165 X:20797816-20797838 TCTTTATTAGAGAAATTTGATGG - Intergenic
1188660997 X:32758506-32758528 CCATTATTTTATCAAGTGGATGG - Intronic
1189522864 X:41788442-41788464 TTTTTATATTAGAAAGTCGAAGG + Intronic
1190139665 X:47831662-47831684 TCTTTATTATACAATGTAGAGGG - Intergenic
1191021600 X:55866638-55866660 ACTTTGGTTTAGAAAGGGGAGGG + Intergenic
1191056581 X:56247828-56247850 ACTTTTTTTTAGTAAGTAGAAGG + Intronic
1191865865 X:65703375-65703397 ACTGAATTTTAGAAAGAGGAAGG + Intronic
1193204796 X:78736091-78736113 CCTTTGCTTTAGAAAGGGGAGGG - Intergenic
1193805966 X:85994825-85994847 TCTTTATTTTTGAAAGAGGAAGG + Intronic
1194409024 X:93534099-93534121 TCTTTATCTGAGAAAGTAGATGG + Intergenic
1194588470 X:95767440-95767462 TATTTATTTTAGAAATTAGTTGG - Intergenic
1194675911 X:96793470-96793492 TCTGTTGTTTAAAAAGTGGAAGG - Intronic
1194771351 X:97909666-97909688 TCTTTGTTTTGCAAAGTGGTGGG + Intergenic
1194919007 X:99741246-99741268 TCTTGATTTGAGGAAGGGGAGGG + Intergenic
1195060061 X:101185621-101185643 TGTTAATTTTAGAAACTGGAAGG + Intergenic
1195562645 X:106301027-106301049 TGTTTATTGTGGAAAGTGAAGGG - Intergenic
1195781077 X:108464886-108464908 TTGATATTTTAGAAAGTAGAAGG - Intronic
1195835294 X:109108096-109108118 TCCTTATTTTAGGGAGTTGAGGG - Intergenic
1196702065 X:118680418-118680440 TTTTTATTTTATTCAGTGGAAGG - Intronic
1196881418 X:120201190-120201212 TTTGTTTTTTAGAAAGTGGGTGG - Intergenic
1198697501 X:139357970-139357992 TTTTTGTTTTTGAAAGTGCATGG - Intergenic
1199036694 X:143059348-143059370 TCTTCATTTTAGAAAAGGAAGGG - Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199833915 X:151569836-151569858 CCTTTCTTTCAGGAAGTGGAAGG + Intronic
1201345127 Y:12975223-12975245 TCATTATTTTTGAAATTGGATGG + Intergenic
1201956048 Y:19624098-19624120 TCTATATTTTGGAAAGTTGTAGG - Intergenic