ID: 1101282242

View in Genome Browser
Species Human (GRCh38)
Location 12:103270304-103270326
Sequence CATTTCTACTAGATGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101282242 Original CRISPR CATTTCTACTAGATGGAAGT AGG Intronic
900029729 1:362478-362500 TATTTGTACAAGATGGAACTAGG + Intergenic
905587534 1:39132654-39132676 CATTTCTTCCAGAAGGAAGGGGG - Intronic
910168341 1:84351811-84351833 CATTTCCATGAGAGGGAAGTAGG - Intronic
911042841 1:93605193-93605215 CATTCCTCCTAGAGAGAAGTCGG + Intronic
911946072 1:104111031-104111053 AATTTCTAGAAGATGGAAGCAGG - Intergenic
916336994 1:163684130-163684152 CATTCCTACTCAATGGAAGCTGG + Intergenic
916457309 1:164984064-164984086 CATTTCAACTGGATAGAATTGGG + Intergenic
1063746858 10:8893616-8893638 ATATTCTACTAGTTGGAAGTGGG + Intergenic
1065781136 10:29168912-29168934 CAATTCTACTAGTAGGAAGCAGG - Intergenic
1065821007 10:29525650-29525672 CTTCTCTTCTAGCTGGAAGTTGG - Intronic
1070386856 10:75933648-75933670 TATTTCTACGAGGTGGTAGTGGG - Intronic
1073539765 10:104308464-104308486 CATTTCTTCTTGATGGGAATAGG - Intergenic
1073912415 10:108361716-108361738 CATTACAACAACATGGAAGTGGG + Intergenic
1078118419 11:8480149-8480171 CCTTTATATTAGATGGAAATCGG - Intronic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1081303824 11:41486736-41486758 TATTTCTATTAGATGAAAGTTGG + Intergenic
1083196056 11:61088406-61088428 CAGATCTACTAGAAGTAAGTTGG + Intergenic
1085916884 11:80900833-80900855 CATTTGTCCTAGAAGGAAGAAGG + Intergenic
1087407436 11:97746811-97746833 CATTTCTATTATATTGAAATAGG + Intergenic
1089757695 11:120698549-120698571 CATTACTAAGAGATGGTAGTGGG - Intronic
1089926055 11:122258939-122258961 GATATCTACTAGATGCAATTTGG - Intergenic
1093758225 12:22876342-22876364 CCTTTCAACTATGTGGAAGTTGG - Intergenic
1095440302 12:42232746-42232768 GATTTCTACCAGATGATAGTTGG + Intronic
1095859504 12:46900874-46900896 CATTTTTAATAGATGGGAATTGG + Intergenic
1097680319 12:62642886-62642908 CATTTCTTCTCCATGGAAGATGG - Intergenic
1098078043 12:66754734-66754756 CATTTCTCCTACATGAAAATGGG - Intronic
1098616277 12:72528106-72528128 CTTTTATATTAGATGGAAATTGG + Intronic
1098855220 12:75645178-75645200 CATCTCTAATAGGTGGAAGACGG - Intergenic
1099081847 12:78193537-78193559 CATATCTACCAGATGGGAGTTGG - Intronic
1099686778 12:85899675-85899697 CTTTTCTAGTAGATGGAAGCTGG + Intergenic
1101282242 12:103270304-103270326 CATTTCTACTAGATGGAAGTAGG + Intronic
1102941419 12:116945909-116945931 CATTTCTAGTAAATGTAAGAGGG + Intronic
1105154234 13:17322651-17322673 TTTTTCTAGTATATGGAAGTTGG + Intergenic
1105346722 13:19579691-19579713 CATTTAAACAAGATGGAAGTGGG - Intergenic
1105923391 13:24985192-24985214 CATTTTTTCTAGATGGCTGTGGG - Intergenic
1106027080 13:25965653-25965675 AATTTCACCTAGATGAAAGTGGG - Intronic
1106754133 13:32804774-32804796 TATTCCTACTAGATGGATGGAGG - Intergenic
1106949043 13:34862071-34862093 CATTTCTAGTAAGTGGAACTTGG - Intergenic
1107819865 13:44276864-44276886 CATTTCTTAGAGATGGAATTGGG - Intergenic
1108451322 13:50568021-50568043 CATTTGTATAAGTTGGAAGTAGG - Intronic
1109200532 13:59425955-59425977 CATTTATCCTCGATGGATGTTGG - Intergenic
1109410245 13:61955507-61955529 CATTTCTTCTATATGTAATTTGG + Intergenic
1112889995 13:104217940-104217962 AATATCTACTAGATGGATTTAGG + Intergenic
1113692228 13:112319090-112319112 CATTCCTTCTGGATGGAGGTAGG + Intergenic
1114394529 14:22345005-22345027 CATTTCTACTGGCAGGAAGCAGG - Intergenic
1117661040 14:58005243-58005265 CATTTCTGCTGGATGGCAGCAGG + Intronic
1117854636 14:60015696-60015718 CATTATTACTGGGTGGAAGTGGG + Intronic
1118677262 14:68200618-68200640 CAATTTTACTTGAAGGAAGTTGG + Intronic
1120489295 14:85156239-85156261 TATTAATACTAGATAGAAGTTGG - Intergenic
1121158026 14:91705412-91705434 GATTTCTGCAAGATAGAAGTTGG + Intronic
1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG + Intergenic
1127062347 15:55199870-55199892 AATTCCTACTAGATATAAGTTGG + Intergenic
1133893310 16:9902317-9902339 CATTGCAACTAGAAGGAAGGAGG - Intronic
1135102771 16:19621305-19621327 GATTTCTAGGACATGGAAGTTGG + Intronic
1135417833 16:22282319-22282341 CCTTTCTCCTGGATGCAAGTGGG + Intronic
1136250642 16:29002403-29002425 GCTGTCTACTAGATAGAAGTTGG + Intergenic
1140642733 16:76995552-76995574 AATCCCTACTTGATGGAAGTTGG + Intergenic
1143123226 17:4622988-4623010 AATTTCTATTAGCTGGAAATTGG + Intergenic
1145996279 17:29106685-29106707 CATTCCTCCTAGAAGGAAGGTGG - Intronic
1146861191 17:36300628-36300650 CTGTTTTACTAGATGGATGTTGG - Intronic
1147091522 17:38104732-38104754 CTGTTTTACTAGATGGATGTTGG - Intergenic
1147105690 17:38215773-38215795 CTGTTTTACTAGATGGATGTTGG + Intergenic
1149242427 17:54665664-54665686 CATGTATACTAAATTGAAGTCGG - Intergenic
1152950028 17:83224082-83224104 TATTTGTACAAGATGGAACTAGG - Intergenic
1156657458 18:39305958-39305980 CTTTTCTACTAGATGGAGTTAGG - Intergenic
1157635040 18:49144568-49144590 GATTTCTACTAAAAGGAACTGGG - Intronic
1159494398 18:69181749-69181771 CATATCTACTAGCTCGAAGTAGG - Intergenic
1162394196 19:10406803-10406825 CATTTCTACAAAATTGAAGATGG + Intronic
928383156 2:30838626-30838648 CATTTATAATATATGGAGGTAGG - Intergenic
928470912 2:31574692-31574714 AATTTCTGCTACATGTAAGTGGG - Intronic
933337688 2:80979839-80979861 CATTTCGGATAAATGGAAGTTGG + Intergenic
934093617 2:88577546-88577568 CATCTCTACTAAAAGGCAGTTGG - Intronic
935197244 2:100824642-100824664 CATCTCTCCTAGATGGCAGGAGG - Intronic
937279841 2:120710259-120710281 CACTTCTTCTAGCTGGAGGTGGG - Intergenic
943968352 2:194367929-194367951 CATTTCTACTAGATAAAGTTTGG + Intergenic
947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG + Intergenic
1169724882 20:8717659-8717681 CATTTCTATTAGCTGGAATCTGG + Exonic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171219409 20:23381450-23381472 AATTTCTACTATATGGTATTCGG - Intronic
1177950090 21:27524502-27524524 AATTTCTACTTGACAGAAGTTGG - Intergenic
1179438115 21:41375826-41375848 CATTACTACTAGAGGAAAGGGGG + Intronic
1182044378 22:27262815-27262837 AGTTTCTACTTGATGGAAGAGGG + Intergenic
949470417 3:4390219-4390241 CATTACTACTAGATGTGGGTAGG + Intronic
949907513 3:8870910-8870932 CATTTCTAAAAGATGGCTGTTGG + Intronic
954088543 3:48266439-48266461 CATTTCTTCTGGATGGATGGGGG - Intronic
954224511 3:49173409-49173431 CATTTCTAAGAGATGGGGGTGGG + Intronic
954713212 3:52514974-52514996 CATTTCTCCTAGAGGGAAAAAGG - Exonic
960731171 3:120728749-120728771 CATTTCTATAAGTTTGAAGTAGG - Intronic
960980444 3:123219416-123219438 AATCTATACTACATGGAAGTTGG + Intronic
962226262 3:133612590-133612612 CATTTTTCCTAGAAAGAAGTTGG - Intronic
964808679 3:160639339-160639361 CATTGGTACTAGATAGAAGCAGG - Intergenic
971104738 4:23512144-23512166 CATTACTCCTAGACAGAAGTAGG + Intergenic
971792595 4:31187764-31187786 TATTTCTACTAGCTGTAAGCTGG - Intergenic
971800722 4:31286498-31286520 CATTTGTTATAGATGGAATTGGG - Intergenic
972727127 4:41754618-41754640 CATCTATAGTAGTTGGAAGTAGG - Intergenic
973842584 4:54877111-54877133 CATTTGAACTTGATGGAAGATGG - Intergenic
974144363 4:57928359-57928381 CATTTGTTTGAGATGGAAGTTGG - Intergenic
974597600 4:64035257-64035279 CAAGTATACTAGATGGAAATTGG + Intergenic
978543327 4:109842734-109842756 CCTTTATGCTAGATTGAAGTGGG - Intronic
978678448 4:111348499-111348521 TCTTTCTACTATTTGGAAGTAGG + Intergenic
979669805 4:123350350-123350372 CATTTCTAGTAGGTGGTAGCAGG + Intergenic
979742997 4:124174709-124174731 CATTTCAAGTAGATGCAAGGAGG + Intergenic
981213053 4:142131377-142131399 CATTTTTACTAGGTGAATGTAGG + Intronic
981322222 4:143405867-143405889 CATTTGGAGTAGATGGAATTTGG - Intronic
982009157 4:151090307-151090329 GATTTTTACTGGCTGGAAGTGGG - Intergenic
982123493 4:152163965-152163987 CATTTCTACCAAAGAGAAGTTGG - Intergenic
983222949 4:165060192-165060214 CATTTCTGGGAGATTGAAGTGGG + Intergenic
984991026 4:185381315-185381337 CTTTTCTACTTGATGGACTTTGG + Intronic
985986913 5:3523605-3523627 CATCACTAGTAGATGGGAGTGGG - Intergenic
992525721 5:77608635-77608657 CATTTCTTTTAAATGGAATTAGG - Intronic
992715511 5:79507310-79507332 CAATTCTTCTAGATGGTAGATGG + Intronic
993436314 5:87900005-87900027 CAATTCAACCAGATGTAAGTTGG - Intergenic
994085051 5:95749423-95749445 CATTTATATTTGATGGAAATTGG - Intronic
994867620 5:105297124-105297146 CATTCCTGGAAGATGGAAGTTGG + Intergenic
996914812 5:128699669-128699691 CATTTCTACAGGTTGGAATTTGG - Intronic
1000182495 5:158825033-158825055 GATTTGTTCTAGATGGAATTTGG - Intronic
1002744260 5:181457894-181457916 TATTTGTACAAGATGGAACTAGG - Intergenic
1005195746 6:23281938-23281960 TATTTCTACTAGATCAATGTGGG - Intergenic
1006920132 6:37622362-37622384 CATTTCAACTGGAGGGAAGGAGG - Intergenic
1010558202 6:77312203-77312225 CATTTCTACTGGATGCAAGGAGG - Intergenic
1012796386 6:103767912-103767934 GTTTTCTACTACCTGGAAGTGGG - Intergenic
1012858805 6:104534297-104534319 CATTTTTACTAGCTGAATGTAGG + Intergenic
1015882577 6:137883788-137883810 CATTTGTACTGGATGGGAGGTGG - Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1017670554 6:156765796-156765818 TATTTCTAAAAGATGGAAGCAGG + Intergenic
1021248219 7:18291090-18291112 CAATTCAACTAGATTGAAGGAGG - Intronic
1026658464 7:72277735-72277757 CATTTCTCCCAGAAGGAAGATGG - Intronic
1028429250 7:90728329-90728351 CATTTTTATTAGTTGGATGTTGG + Intronic
1033578625 7:142711306-142711328 CATTTCTTCTAGAACTAAGTTGG + Intergenic
1033859811 7:145610737-145610759 CATTACTACATGATGAAAGTTGG - Intergenic
1035498925 8:76212-76234 TATTTGTACAAGATGGAACTAGG + Intronic
1035907954 8:3534609-3534631 CTTTTCTGCTAGATGTCAGTTGG + Intronic
1036714756 8:11110391-11110413 CATTTCTATTAGATGGCTTTTGG - Intronic
1037083776 8:14820425-14820447 CTTTTTTCCTAGATGAAAGTGGG - Intronic
1038212427 8:25531978-25532000 CATTTTTACTAGAGTGAATTGGG - Intergenic
1041481824 8:58330689-58330711 CTTTTCTACTAGATAGCAGGTGG - Intergenic
1043185646 8:77145488-77145510 CATTTCTACTTGATTGCAGGTGG + Intergenic
1047971029 8:130084744-130084766 CATATCTACTTATTGGAAGTGGG - Intronic
1051667518 9:19479446-19479468 CATTGCTAGTGGATGGAAATAGG - Intergenic
1052274583 9:26663132-26663154 CATTTCTTATAAATGGAAGATGG + Intergenic
1055101905 9:72474535-72474557 CACCTCTACTATATGGAGGTGGG - Intergenic
1055277555 9:74636239-74636261 CATTTCTACCATGTGGCAGTAGG + Intronic
1058002626 9:99881640-99881662 CATATGAACTAGAAGGAAGTTGG + Intergenic
1059559189 9:115315733-115315755 TATGTCTACTCTATGGAAGTGGG - Intronic
1059611420 9:115901345-115901367 CATTTATACTTGATATAAGTTGG - Intergenic
1060438118 9:123613452-123613474 CACTTCTAGTAGATGGATTTTGG - Intronic
1203610072 Un_KI270748v1:88387-88409 TATTTGTACAAGATGGAACTAGG - Intergenic
1186022297 X:5269820-5269842 CATTTCTACTACATTAAAATGGG + Intergenic
1189503489 X:41586468-41586490 CATTTCTACTATATGGAAAATGG - Intronic
1193405631 X:81097816-81097838 AGCTTCTACTAGATGGATGTTGG - Intergenic
1196262775 X:113604111-113604133 GATTTCTACCATATGGAAGATGG - Intergenic
1196687582 X:118525178-118525200 CAATTCTATTAGGTGGAATTGGG + Intronic
1198552376 X:137758431-137758453 CATCTCTACAAGGAGGAAGTTGG - Intergenic
1198714149 X:139538449-139538471 GATTTCCAATTGATGGAAGTTGG - Intronic
1199813850 X:151379087-151379109 CATTTCTAATAAATGGAATATGG + Intergenic
1201647978 Y:16256442-16256464 CACTTCTACTACATGTAAATGGG - Intergenic
1201654832 Y:16328859-16328881 CACTTCTACTACATGTAAATGGG + Intergenic
1201975450 Y:19843763-19843785 GATCTCTAATAGATGGAGGTAGG + Intergenic