ID: 1101285341

View in Genome Browser
Species Human (GRCh38)
Location 12:103306192-103306214
Sequence TCAGTTTCACTGGATGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101285333_1101285341 18 Left 1101285333 12:103306151-103306173 CCTCAGTTTCTCCTCTGGCAGTA 0: 1
1: 0
2: 3
3: 13
4: 266
Right 1101285341 12:103306192-103306214 TCAGTTTCACTGGATGGTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 160
1101285334_1101285341 7 Left 1101285334 12:103306162-103306184 CCTCTGGCAGTAAAAATCAATGG 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1101285341 12:103306192-103306214 TCAGTTTCACTGGATGGTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101285341 Original CRISPR TCAGTTTCACTGGATGGTGC TGG Exonic
902047833 1:13539201-13539223 GCAGCTTCACTGGATGGTTCTGG - Intergenic
905906776 1:41623704-41623726 TCAGGTTCCCTGGATGGTGGTGG - Intronic
906458922 1:46022570-46022592 ACTGCTTCACTGGATGGGGCTGG - Intronic
907870185 1:58436011-58436033 TCAGTTAAACAGGCTGGTGCTGG - Intronic
908400885 1:63772064-63772086 TCAGTTACACTGCACAGTGCTGG - Intergenic
908470741 1:64441541-64441563 TCATTTTCACTGGGTGGTCAGGG + Intergenic
909952737 1:81738677-81738699 TCAGTTTCACTGTATGGAATAGG - Intronic
910393434 1:86768056-86768078 ACAATTACACTGGATTGTGCAGG - Intergenic
910958918 1:92739810-92739832 TCAGTTTCACAGTATGATTCAGG - Intronic
916335210 1:163663292-163663314 TCTGTTTCATTGGTTGGTTCTGG - Intergenic
918581087 1:186130600-186130622 TCTGTTCCACTGGATGGTTGGGG - Exonic
919058540 1:192601380-192601402 ACAGTTTCACTGTATTCTGCTGG - Intergenic
922223025 1:223622870-223622892 TCAGCTTCTCTGGATGGCCCTGG + Exonic
923333184 1:232944726-232944748 GCATTTTCTCTGGCTGGTGCCGG - Intergenic
924558434 1:245137228-245137250 ACAGTCTCAATAGATGGTGCTGG - Intergenic
924789701 1:247233953-247233975 TTATTTTCAATGAATGGTGCTGG + Intergenic
924804092 1:247348719-247348741 TCAGTTTCTCTGGATTGTTATGG + Intergenic
1066003482 10:31126483-31126505 CAAGTTTCACTGGCTGTTGCAGG + Intergenic
1069714105 10:70509616-70509638 TCATTTCCACTGGATGTTGATGG + Intronic
1070407154 10:76107132-76107154 TCAGTTGCTCTGGCTGGGGCTGG + Intronic
1076482645 10:130794859-130794881 GCAGGTGCACAGGATGGTGCAGG + Intergenic
1079712149 11:23698988-23699010 TGAGCTTCACAGGATAGTGCAGG + Intergenic
1081298778 11:41425055-41425077 TCATTTTCACTGGCTGTTTCAGG + Intronic
1083033227 11:59613669-59613691 TAAGTTTAAATGGATGGTCCTGG + Intronic
1083358219 11:62084029-62084051 TCAGCTATACTGGATGTTGCTGG + Intergenic
1084742995 11:71151107-71151129 TCAGTGTACCTGGATGGTGAGGG - Intronic
1086382097 11:86265688-86265710 TCAGTTTCATTGGTTGGTTGAGG + Intronic
1086676767 11:89618032-89618054 TCAGGTTCTCTTTATGGTGCTGG + Intergenic
1088599645 11:111463065-111463087 TGAGTTTCAGTGGGTGGTGAGGG + Intergenic
1091590014 12:1837275-1837297 TCAGCCTCACTGGATGCTGGCGG + Intronic
1092936466 12:13368463-13368485 CCATTTTCACTGGGTGGTGGTGG + Intergenic
1094418183 12:30239813-30239835 TCAGCTTCTCTGGTTGGTCCTGG - Intergenic
1094427080 12:30327233-30327255 ACAGTTTGTCTGGATGGTGAGGG - Intergenic
1095317513 12:40784103-40784125 TCATTTTGACTGGGTGGTTCAGG + Intronic
1095848321 12:46771935-46771957 TCAGAGGCCCTGGATGGTGCTGG - Intronic
1096989144 12:55784740-55784762 TAAGTTTTACTGGACAGTGCTGG + Intronic
1097271112 12:57774803-57774825 TCAGAAACACTGGAGGGTGCCGG + Intronic
1100451326 12:94709661-94709683 TCTGTTTCAATAAATGGTGCTGG + Intergenic
1101285341 12:103306192-103306214 TCAGTTTCACTGGATGGTGCTGG + Exonic
1102195143 12:111020115-111020137 TCTGCTTCACTGGATGTAGCTGG + Intergenic
1103739334 12:123080893-123080915 GCAGCTGCACTGGATAGTGCAGG - Intronic
1105051184 12:133052524-133052546 ACAGTTTCACTGTGTGGTCCAGG + Intronic
1106956969 13:34950128-34950150 TCAGTTTCTCTGTCTGGTCCAGG - Intronic
1108074558 13:46666452-46666474 TCCGTCTCACTAGTTGGTGCAGG - Intronic
1109497103 13:63187356-63187378 TCAGTTTCCCAGGAAGGTGGTGG + Intergenic
1111340856 13:86883531-86883553 TCAGAATCTCTGGATAGTGCAGG - Intergenic
1111889321 13:94061929-94061951 AGAGTTTCTCTGGATGATGCTGG + Intronic
1113521624 13:110946078-110946100 TCAGTTTCCCAGGAAGGCGCTGG + Intergenic
1114389403 14:22290460-22290482 TCAGTTTGACAGAAAGGTGCAGG - Intergenic
1115016900 14:28628015-28628037 TCAGTTTGCCTAGATGGTGGTGG + Intergenic
1117487048 14:56208416-56208438 TCTATTTCACTGGAAGGTGTAGG + Intronic
1117871899 14:60209854-60209876 TCCTTTTCACTAAATGGTGCTGG + Intergenic
1118437574 14:65785525-65785547 TCTGTTTCTCTTGAAGGTGCTGG + Intergenic
1118600004 14:67465356-67465378 TCAGTCTCCCTGGATGGCACAGG + Intronic
1119804923 14:77476272-77476294 TCAGGTTGTCTGGATGGTGTGGG - Intronic
1119870921 14:78016265-78016287 TAAGTCTCAGAGGATGGTGCCGG + Intergenic
1120510500 14:85407996-85408018 CCAGTTTCACTGGAGAGTGGGGG - Intergenic
1120735763 14:88050552-88050574 TCAGGGTCACTGGGTGGTGCAGG - Intergenic
1121666171 14:95673967-95673989 GCAGTTTCAGTGGAGGCTGCAGG + Intergenic
1129678086 15:77643230-77643252 TCAGGTCCCCTGGATGGTGCTGG + Intronic
1130673914 15:85935917-85935939 TCAGATGCACTGCATGGTCCAGG - Intergenic
1131212989 15:90513588-90513610 TGAGTCTCCCTGGATGGTGGAGG - Intergenic
1132742114 16:1419969-1419991 TCAGTTGCACTGTATGCTGTTGG - Exonic
1137449155 16:48554815-48554837 TTAGTTTCACTGGAATTTGCAGG - Intronic
1138959361 16:62010461-62010483 TCATTTCCACTAGAAGGTGCAGG - Intronic
1141634848 16:85309027-85309049 TCAGTTCCACAGGATGGGGCGGG + Intergenic
1142167678 16:88601443-88601465 CCAGTTTCCCTGGCTGGAGCAGG + Intronic
1143201493 17:5116354-5116376 TCGGTTCGACTCGATGGTGCGGG - Intronic
1144242934 17:13331776-13331798 TCAGTCTCACTGGATGATCCAGG - Intergenic
1152189730 17:78881165-78881187 TCAGTATCACTGGAGGGCACTGG + Intronic
1153000734 18:453198-453220 TCAGTGTCACTGGCTTGTTCTGG + Intronic
1153257486 18:3186420-3186442 TCAGTTTTACTCTCTGGTGCAGG - Intronic
1156286202 18:35698637-35698659 AAAGTTCTACTGGATGGTGCTGG + Intronic
1156474309 18:37395885-37395907 TCAGTCTAGCTGGATGGGGCTGG - Intronic
1158436180 18:57436619-57436641 TCAGTCTCACGGGCCGGTGCTGG + Exonic
1160103223 18:75944057-75944079 TCAGTCTCCCTGGGTGGTCCAGG + Intergenic
1160728153 19:627609-627631 AAAGTTCTACTGGATGGTGCTGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1164061374 19:21678262-21678284 AGAGTTACACAGGATGGTGCAGG + Intergenic
1164065281 19:21709450-21709472 AGAGTTACACAGGATGGTGCAGG - Intergenic
1166897584 19:46033522-46033544 TCAGCTTCCCTGGCTGGAGCTGG - Intergenic
1166930788 19:46300019-46300041 TCAGTGTCAATGGAGGGCGCTGG + Intronic
925185896 2:1846156-1846178 TCAGTTTCCCTTAATTGTGCAGG + Intronic
925882251 2:8362711-8362733 TGATTTTCACTGGATGAAGCTGG - Intergenic
928675010 2:33642065-33642087 TGAGTTTCACAGGGAGGTGCTGG - Intergenic
929319292 2:40522228-40522250 TCATTTTCTCTGGATTGAGCGGG - Intronic
930692976 2:54383284-54383306 GCAGCTTAACTGGATGGTTCTGG - Intronic
931553187 2:63469889-63469911 GCAGTTTCAATGGAAGGTGATGG - Intronic
933157379 2:78991289-78991311 TCAGTTGCAAGGGATGGTCCAGG + Intergenic
936400269 2:112159634-112159656 TCAGTCTCAATGGGTGGTGGCGG + Intronic
942921438 2:181378438-181378460 TAAATTGCACAGGATGGTGCAGG + Intergenic
943871229 2:193003635-193003657 CCAGATTCACTAGATGGTGTAGG + Intergenic
944604120 2:201334315-201334337 TCAGTCTCACTGGATCATGGTGG + Intronic
1169655595 20:7919209-7919231 TCAGTGTTACTTGATGGTGTAGG - Intronic
1169984847 20:11432758-11432780 CCAGTTTCAAGGGATGGGGCAGG + Intergenic
1172798221 20:37558069-37558091 TCAGTTTCACTGGAGAGGGTAGG + Intergenic
1172977787 20:38919608-38919630 TGGGTTTTACTGGCTGGTGCTGG + Exonic
1173169284 20:40710595-40710617 TCAGCTTCACTGGATGTGGATGG - Intergenic
1175241123 20:57550202-57550224 TCAGGTTGAATGGATGTTGCAGG + Intergenic
1179557860 21:42192083-42192105 TCTGTTTTACTGGACAGTGCAGG - Intergenic
1184493564 22:44824436-44824458 TCAGTGACACAAGATGGTGCAGG - Intronic
950211050 3:11123828-11123850 TGTGTTTCATTGGATAGTGCTGG + Intergenic
950406158 3:12806393-12806415 TCAGATTCAGGGGATGGAGCAGG + Intronic
950860514 3:16143940-16143962 CCAGTCTCACTGGCTGGTGGGGG - Intergenic
953792084 3:45955276-45955298 TCAGTTTCAGTGGGTGTTTCAGG + Exonic
954772974 3:52990002-52990024 ACAGTTTTAGTAGATGGTGCTGG - Intronic
954901287 3:54022185-54022207 TCAGGGTCACTAGATGGGGCAGG + Intergenic
955244268 3:57209303-57209325 GAAGTTTTACTGGATAGTGCTGG + Intronic
958691361 3:97471741-97471763 TTATTTGCACTGGATGGTTCTGG - Intronic
962296555 3:134194183-134194205 TCAGGTTAACCAGATGGTGCTGG - Intronic
962909943 3:139838796-139838818 TCAGTTACACAGCATGCTGCTGG - Intergenic
964431349 3:156609886-156609908 TTTATTTCAGTGGATGGTGCTGG - Intergenic
965293336 3:166912160-166912182 TCAGTTTCAGTGTATGATGAGGG + Intergenic
968339771 3:197945426-197945448 GCAGGTTAGCTGGATGGTGCTGG - Intronic
969096826 4:4739032-4739054 TCAGTTTCATCAAATGGTGCTGG + Intergenic
972883636 4:43457670-43457692 TCTCTTCCACTGGATGTTGCAGG + Intergenic
973022712 4:45223703-45223725 TCAGATTCAATAAATGGTGCTGG - Intergenic
975848708 4:78550264-78550286 TCAGAATCACTTGATGGCGCAGG + Intergenic
976318596 4:83685969-83685991 TCAGTATCACTGGATGAAGAAGG - Intergenic
978449324 4:108813442-108813464 TTAGTTTCAATGGGTGGTGTAGG + Intronic
979199882 4:117964610-117964632 TCAGGGACACTGGATGGAGCTGG - Intergenic
986770055 5:10964746-10964768 TCAGTTTCAGGGGATGGGGTGGG - Intergenic
990344011 5:54853637-54853659 AAAGTTCCACTGGATAGTGCTGG + Intergenic
991440808 5:66646700-66646722 TCAGCTTCAGTGGATGATGTTGG + Intronic
992883117 5:81130393-81130415 TCAGTTTCAATGGCTAGTGGCGG + Intronic
995858325 5:116616275-116616297 TCAGTTAAACTGGATGGGCCCGG - Intergenic
996090103 5:119342295-119342317 TCATGTTCAGTGGCTGGTGCTGG - Intronic
1000113134 5:158128152-158128174 TCAGTTTAAATGCATGGTTCTGG + Intergenic
1000230905 5:159314177-159314199 TGAGTCTTCCTGGATGGTGCTGG + Intergenic
1001487701 5:172131388-172131410 ACAGTTTCACTGAAAGATGCAGG - Intronic
1003007993 6:2399259-2399281 GCAGTTTAGCTGGATGGTTCTGG + Intergenic
1013164489 6:107577453-107577475 TCAGTTTCACTGATTGGTCCAGG + Intronic
1014347937 6:120299069-120299091 TCTGTTTCAATATATGGTGCTGG + Intergenic
1015585891 6:134776037-134776059 TCAGTCTCACTGGGAGTTGCAGG - Intergenic
1016923695 6:149318603-149318625 TAAATTTCACTGGATGTTTCTGG + Intronic
1019806986 7:3134990-3135012 GCAGTTTAACTGGGTGGTTCTGG - Intergenic
1020693940 7:11392131-11392153 TCAATCTCACTGGAAGCTGCAGG - Intronic
1022332202 7:29390704-29390726 TCAGTTTCACAGGTGGGTCCTGG + Intronic
1023021027 7:36011827-36011849 AGAGCTTCACTGCATGGTGCAGG - Intergenic
1023212319 7:37819995-37820017 TCAGCTTCTCTGGGTGGAGCAGG + Intronic
1028990058 7:97039588-97039610 GCAGTATCAGTGGATGGAGCTGG + Intergenic
1032441399 7:131945466-131945488 CCGGTTTCTCTGGAGGGTGCGGG + Intergenic
1033153043 7:138933169-138933191 GCAGTTTCACTGCATGAGGCAGG + Intronic
1034907532 7:154963930-154963952 TCATTTTCATTGTATGGTGCTGG - Intronic
1037913263 8:22756891-22756913 GCAGGTTCCCTGGATGATGCTGG + Intronic
1038030921 8:23638426-23638448 TCAGTCTCTCTGGAGGCTGCAGG - Intergenic
1039237487 8:35517837-35517859 GCAGTTTCAGTGTCTGGTGCAGG + Intronic
1041873265 8:62659575-62659597 TCTGTTGCACTGGATGGAGATGG + Intronic
1043788996 8:84438816-84438838 TCATTTTCAATCAATGGTGCTGG - Intronic
1044790122 8:95838570-95838592 TCAGTTTCCTTGGCTGTTGCTGG - Intergenic
1047371750 8:124261667-124261689 GCAGTGTCTCTGGATGGTGAAGG + Intergenic
1047709704 8:127539369-127539391 TTAGTTTCCCTAGATGGTTCTGG + Intergenic
1048427107 8:134332915-134332937 TCTTTCTCACTGGATGGTGGGGG - Intergenic
1049935036 9:493455-493477 GCTGCTTCACTGGATGGTTCTGG - Intronic
1053299964 9:36941852-36941874 CCAGGCTCACTGGATGATGCAGG + Intronic
1055115894 9:72605309-72605331 GCAGATTCACTGGGTGGTTCTGG + Intronic
1056363313 9:85880322-85880344 ACATTTTCACTGGATGGTAGAGG - Intergenic
1057208964 9:93189288-93189310 TGAGTTTCCCAAGATGGTGCTGG + Intronic
1060374180 9:123103776-123103798 TCTGTTAAACTGTATGGTGCAGG + Exonic
1061855201 9:133438199-133438221 CCCGTGTCACTGGAGGGTGCTGG - Intronic
1185887136 X:3792888-3792910 TAAGTTTCACAGGTTGGTGTGGG + Intergenic
1189684476 X:43549640-43549662 TCAGCTTAACTGGGTGGTTCTGG - Intergenic
1190373678 X:49767161-49767183 TCATTTTCACTGCCTGGTCCTGG - Intergenic
1194577362 X:95628772-95628794 TCATGTTCTCTGGATGGTGGAGG - Intergenic
1196265109 X:113634301-113634323 TCAGTTTCACTGGTTGCTTTGGG - Intergenic
1196416958 X:115481511-115481533 TCAGTTTCACTGTATGCTAAAGG + Intergenic
1199447569 X:147943836-147943858 TCAGGTTCACTGAAAGGTACTGG - Intronic
1201146733 Y:11068864-11068886 TCAGTGTACCTGGATGGTGAGGG - Intergenic
1202029749 Y:20559178-20559200 TTAGATTCATTGGATTGTGCTGG + Intergenic